ID: 1173428692

View in Genome Browser
Species Human (GRCh38)
Location 20:42966557-42966579
Sequence CAGAGTTTCTACTATAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173428692_1173428694 4 Left 1173428692 20:42966557-42966579 CCCAACTTATAGTAGAAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1173428694 20:42966584-42966606 CATACACCCAGTGAACAAGACGG 0: 1
1: 0
2: 0
3: 11
4: 145
1173428692_1173428695 7 Left 1173428692 20:42966557-42966579 CCCAACTTATAGTAGAAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1173428695 20:42966587-42966609 ACACCCAGTGAACAAGACGGTGG 0: 1
1: 0
2: 0
3: 9
4: 93
1173428692_1173428699 29 Left 1173428692 20:42966557-42966579 CCCAACTTATAGTAGAAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1173428699 20:42966609-42966631 GGTTTTAGAACATCTTCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 152
1173428692_1173428696 8 Left 1173428692 20:42966557-42966579 CCCAACTTATAGTAGAAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1173428696 20:42966588-42966610 CACCCAGTGAACAAGACGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 70
1173428692_1173428700 30 Left 1173428692 20:42966557-42966579 CCCAACTTATAGTAGAAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1173428700 20:42966610-42966632 GTTTTAGAACATCTTCACCTGGG 0: 1
1: 0
2: 0
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173428692 Original CRISPR CAGAGTTTCTACTATAAGTT GGG (reversed) Intronic
902981166 1:20124401-20124423 CTGAGTTTCTACCATATGTCAGG + Intergenic
906832873 1:49052056-49052078 CAGAGTTTATATTATATGTAGGG + Intronic
907843289 1:58177315-58177337 GAGAGTTTCTTCTATATGTCAGG - Intronic
908964347 1:69740050-69740072 TAGAGGTTCTACTATATGATTGG + Intronic
910210846 1:84790983-84791005 CAGTGTTTCTACCACAAATTAGG - Intergenic
911150720 1:94594947-94594969 CAGAGTATCTTCTAAATGTTAGG - Intergenic
911460732 1:98186878-98186900 CAGAGTTTCTAATATATTTGAGG - Intergenic
913423475 1:118699638-118699660 CTGATTTTCTAATATCAGTTTGG - Intergenic
914559336 1:148802444-148802466 TTGAGTTTCTGCTATGAGTTTGG - Intergenic
914613497 1:149327779-149327801 TTGAGTTTCTGCTATGAGTTTGG + Intergenic
915748746 1:158184765-158184787 CACAGTTTCTATTGTAAATTTGG + Exonic
916508600 1:165451060-165451082 CTGGGTTTCTACTATGAGTTAGG - Intergenic
916792952 1:168140039-168140061 CAGATTTACTAGTACAAGTTAGG + Intergenic
917479083 1:175395138-175395160 CAGAAATTCTGCTATAATTTTGG - Intronic
921300489 1:213746999-213747021 CTGAGTTTTAAATATAAGTTTGG + Intergenic
921986773 1:221320884-221320906 CAGTATTTCTACAAGAAGTTTGG - Intergenic
922139180 1:222864889-222864911 CAGAGTTAATAATATAATTTGGG - Intergenic
923360776 1:233208531-233208553 CAGTGTTTCTACAATCAGCTAGG - Exonic
923966329 1:239143610-239143632 CTGAGTTTTTACTGTAAGCTAGG - Intergenic
1063929427 10:11014455-11014477 CAAAGTTGCTACTATAATTTAGG - Intronic
1064225887 10:13484783-13484805 CTGAATTCCTACTATAAATTTGG + Intronic
1064385136 10:14883738-14883760 CAGATTTTCTAGTATACTTTAGG + Intronic
1065423970 10:25579746-25579768 CACAGTTTCTTCCAGAAGTTAGG + Intronic
1065774343 10:29105560-29105582 CAGAGTGTCTACTATGTGTCAGG - Intergenic
1065957651 10:30707113-30707135 AAGAGTTTCAAGAATAAGTTTGG - Intergenic
1066328208 10:34387924-34387946 TAGAATTTCTACTGTATGTTAGG - Intronic
1068274685 10:54778569-54778591 TAGTGTTTTTACTATAATTTGGG + Intronic
1068364849 10:56034571-56034593 CAAAGATTATACTTTAAGTTCGG + Intergenic
1068640746 10:59403805-59403827 TATAGTTTCAACTTTAAGTTTGG - Intergenic
1068696331 10:59971674-59971696 TTGAGTTTTTACTATAGGTTGGG - Intergenic
1069092590 10:64219588-64219610 CATAGTGTCTACTATGATTTGGG + Intergenic
1069271189 10:66529796-66529818 TAGAGTTTCTTCTATAATTTTGG - Intronic
1070315291 10:75304409-75304431 CAGAGCTTCTACTGTACATTTGG - Intergenic
1070726171 10:78792644-78792666 CTGAGTATCTACTACATGTTCGG - Intergenic
1074570013 10:114615722-114615744 AACAGTGTCTACTATCAGTTAGG + Intronic
1079595189 11:22235854-22235876 CAGAATTTCTACTATAATTAGGG - Intronic
1082946637 11:58768424-58768446 CAGAGTTTCTGATTAAAGTTAGG - Intergenic
1084561505 11:69908072-69908094 CAGAGCTTCAACTTTAGGTTGGG + Intergenic
1085062542 11:73460841-73460863 CTGAGTTTCTTCTATAAAGTAGG - Intronic
1085424163 11:76388425-76388447 CTGAGATTCTACTACAACTTTGG - Intronic
1085560002 11:77462924-77462946 CAAAGTGCCTACTATAGGTTAGG + Intronic
1087177716 11:95110407-95110429 CAGAGTCTCTATTATGACTTAGG + Intronic
1089173415 11:116531942-116531964 CTGAGTCTCTACTATATGCTAGG - Intergenic
1090958103 11:131531668-131531690 TCGAATTTCTACTATGAGTTAGG + Intronic
1091998773 12:5016554-5016576 CAGAGTGTAGCCTATAAGTTTGG - Intergenic
1095563637 12:43594867-43594889 CAGACGTTCTACTGTAAATTGGG - Intergenic
1098732404 12:74053689-74053711 AATAATTTCTACTATAAGTGAGG - Intergenic
1102474872 12:113182051-113182073 CAAGGTATCTACTATAAGCTAGG + Intronic
1105588819 13:21771882-21771904 CAGTCTTTCTAGTGTAAGTTTGG + Intergenic
1106193876 13:27476862-27476884 CTGAGTGTCTACTATATGCTGGG - Intergenic
1107597622 13:41979736-41979758 CAGAGTTTCTGCTACACGTTGGG + Intergenic
1109251487 13:60025930-60025952 CATAGTTTTTTCTTTAAGTTTGG - Intronic
1110052403 13:70920903-70920925 TAGGGTTTCTACTATAAGTGTGG - Intergenic
1110554300 13:76841028-76841050 AAGAGTTTCTAGTATATGTAAGG + Intergenic
1111789596 13:92837734-92837756 CAGAGTTTCTGTTAATAGTTTGG - Intronic
1113128775 13:107010924-107010946 CACAGTTTCTATTATGTGTTAGG + Intergenic
1115384232 14:32777029-32777051 GAGGGTTTCTACTATGAGTGAGG - Intronic
1115797983 14:36960530-36960552 CAGAGTTTGTATTATAAGATAGG - Intronic
1119986745 14:79146991-79147013 CAGAGTCTCTTCTATCAGGTGGG + Intronic
1120601192 14:86512009-86512031 AAGATTTTGTACTAGAAGTTAGG - Intergenic
1121394135 14:93603521-93603543 CTGAGTTTGTTCAATAAGTTTGG + Intronic
1122257999 14:100493644-100493666 CAGAGTTTATAGTTTACGTTAGG + Intronic
1124106471 15:26742329-26742351 CAGAGTTTAAACTAAAAATTGGG - Intronic
1125191506 15:36999233-36999255 TAGAGTGTCTACTATATGCTAGG + Intronic
1125214063 15:37249333-37249355 CAGATGTTCTACCAGAAGTTGGG + Intergenic
1126528020 15:49679550-49679572 CTGAGTTTTTTATATAAGTTTGG - Intergenic
1128708136 15:69852199-69852221 CAGAGTACCTACTGTAAGGTTGG - Intergenic
1128956325 15:71949730-71949752 CAGAGTTCATACTTTAATTTGGG + Intronic
1130248634 15:82279411-82279433 CAAAGTTTCTATTATGAATTTGG - Intronic
1130831820 15:87608702-87608724 CAGATTTTCCACTATAAAGTGGG - Intergenic
1132368175 15:101273409-101273431 CAAAGATTCCACTATAAGTAAGG - Intronic
1132439947 15:101851271-101851293 CAGAGTACATACTATATGTTAGG + Intergenic
1138855981 16:60692357-60692379 CATAGTTTCCAGTATATGTTAGG + Intergenic
1151139912 17:71981445-71981467 CAGAGTTTTTTCAATAAATTTGG + Intergenic
1152184281 17:78844386-78844408 CACCCTTTCTACAATAAGTTCGG + Intergenic
1153066417 18:1050584-1050606 CACGATTTCTTCTATAAGTTTGG + Intergenic
1159132886 18:64300664-64300686 AAGAATTTCTACTTCAAGTTGGG + Intergenic
1159329147 18:66966510-66966532 CAGAAGTACTACTAGAAGTTAGG + Intergenic
1161497212 19:4593187-4593209 CAGAGTTGTTTCTAGAAGTTGGG + Intergenic
1164442363 19:28289119-28289141 CACAGTTTCTCCTTTAAGTGTGG + Intergenic
1168275987 19:55279030-55279052 CTGAGGTTCTACTTTAAGTAGGG - Intronic
1168574140 19:57494353-57494375 CAGAGTTTCTGTTTTAAGTGAGG - Exonic
1168591446 19:57639184-57639206 CAGAGTTTAAGCTAAAAGTTGGG + Intronic
1168609806 19:57790145-57790167 CAAAGTTTCTCCTCTGAGTTGGG + Intronic
925182958 2:1828922-1828944 CAGAGTTAGAACTTTAAGTTTGG + Intronic
926501782 2:13663510-13663532 GAGAATATCTACTATCAGTTTGG - Intergenic
927801406 2:26103207-26103229 CTGAATGTCTACTATAGGTTGGG - Intronic
928937782 2:36698460-36698482 CAGAGCTGTTACTATAATTTAGG - Intronic
929078503 2:38098363-38098385 CAGAATTTCTACTAACAGTGAGG + Intronic
934090261 2:88544955-88544977 CAGAGTTTCTCCTGTCATTTCGG - Intergenic
938709966 2:133967799-133967821 GAGAGTTTCTACTATTGGTAAGG - Intergenic
939597323 2:144142141-144142163 CAGAGTTTATACTACACCTTAGG + Intronic
939629091 2:144513408-144513430 CAGAGTTTCCACTAAAGGGTTGG - Intronic
940631411 2:156244166-156244188 TAGTTTTTCTTCTATAAGTTAGG - Intergenic
941151042 2:161915982-161916004 CATGGTCTCTTCTATAAGTTTGG - Intronic
941708679 2:168688122-168688144 CAGAGCTTTTATTATTAGTTAGG + Intronic
942125149 2:172817113-172817135 CAGAGTATCTCCTATGTGTTAGG + Intronic
942695006 2:178632181-178632203 CATAGCTTCTACTCTAATTTGGG + Exonic
943416526 2:187612856-187612878 CAGAGATTATAGTATAATTTTGG - Intergenic
944031134 2:195236085-195236107 CAGATTTTCTACTTTCATTTTGG - Intergenic
944564984 2:200980779-200980801 CAGAGATTCTGCTATGACTTTGG - Exonic
948747289 2:240105963-240105985 CAGAGTTTCTATTATCACTGAGG - Intergenic
1168982617 20:2020841-2020863 CAGAGCACCTACTATATGTTGGG - Intergenic
1173428692 20:42966557-42966579 CAGAGTTTCTACTATAAGTTGGG - Intronic
1174838295 20:53878288-53878310 TAGAGTTTCTATTGTAAGTCTGG + Intergenic
1174899782 20:54486793-54486815 CTGAGTTTCTACTATGAGTCAGG - Intronic
1177580061 21:23010086-23010108 CAGAGTTTCTGACATAAATTTGG - Intergenic
1177595773 21:23240463-23240485 CAAAGTTTATCATATAAGTTTGG - Intergenic
1179925009 21:44529491-44529513 CAGACTTTCTAAAGTAAGTTAGG + Intronic
1182478925 22:30593920-30593942 CATTCTTTCTACTATACGTTAGG - Intronic
950110851 3:10417678-10417700 CAGACTTTGTTCTATATGTTGGG + Intronic
950471156 3:13187168-13187190 CTGAGTATCTACTATGGGTTAGG + Intergenic
951641011 3:24835501-24835523 CAGACTCTGTACTAAAAGTTCGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955811069 3:62790243-62790265 CAGAGATACTACTATAAAGTTGG - Intronic
955993011 3:64648591-64648613 CAACTTTTCTACTATAAGTGTGG - Intronic
959367668 3:105483278-105483300 CAGAGTGCCTACTATGTGTTAGG + Intronic
960045765 3:113196355-113196377 CAGAGTTGCCTCTATAAGCTTGG - Intergenic
961196732 3:125008491-125008513 CAGAGTTTCTAAGCTAAGTAAGG - Intronic
961783081 3:129332799-129332821 CTAAGCTTCTACTATGAGTTTGG - Intergenic
962020635 3:131497612-131497634 CTGAGTTTGTAGTTTAAGTTTGG - Intronic
964598234 3:158462989-158463011 CTGAGTTTCTACTATGTGTTAGG - Intronic
967110509 3:186289217-186289239 CAAAATTACTTCTATAAGTTGGG - Intronic
967445138 3:189556757-189556779 CAAATTTGCTACTTTAAGTTTGG - Intergenic
970398725 4:15697557-15697579 CAGAGCTTCTACTAAAAATGTGG + Intronic
977007026 4:91580523-91580545 CTGAGTTTCTACAATGAGTCTGG - Intronic
977505429 4:97896845-97896867 AACAGTTGCTACTATTAGTTGGG + Intronic
978167208 4:105623752-105623774 CAGAGTTACTAATATAAATTGGG - Intronic
979218068 4:118190176-118190198 CAGAGTTTTCACTATAAATTAGG - Intronic
979413017 4:120402429-120402451 AAGAAGTTCTAATATAAGTTTGG - Intergenic
980770160 4:137361711-137361733 CAGAGTTTATATTAAAAATTTGG - Intergenic
981281009 4:142958590-142958612 AAGAGTATCTACTATATATTAGG + Intergenic
981382791 4:144092502-144092524 CAGAGTTTCTTGTATGAGGTTGG + Intergenic
982698892 4:158636518-158636540 CAGAGTATCTACCACAAGCTGGG + Intronic
983976895 4:173945496-173945518 CAGACTTACTACTTTAAGTGAGG + Intergenic
986174196 5:5337952-5337974 GACAGTATCTCCTATAAGTTTGG - Intergenic
989137061 5:38166421-38166443 CAGAGTTTCTAATGTAACTCAGG + Intergenic
992530378 5:77646452-77646474 CTGAGCATCTACTATATGTTGGG + Intergenic
994806505 5:104454333-104454355 TTGAGTTTCTACTAAAAGTCAGG + Intergenic
998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG + Intergenic
1001257803 5:170197985-170198007 AGGAGTTTCTATTAAAAGTTGGG + Intergenic
1003069383 6:2932776-2932798 CACAGTTTAAACTATAATTTAGG + Intergenic
1003993953 6:11519497-11519519 CTGATTATCTACTATAAATTTGG - Intergenic
1004112530 6:12733323-12733345 CATAGTTTCTGTTATATGTTAGG - Intronic
1004157838 6:13185869-13185891 CAGTGTTTCTCCTATAAGATAGG - Intronic
1007997681 6:46325916-46325938 CAGAGTTTCTTCTTTGAGGTGGG + Intronic
1008429950 6:51404425-51404447 CATAATTTCTACTATTAATTAGG + Intergenic
1009355231 6:62735781-62735803 CAAAGTTTCTATGATAAGATAGG - Intergenic
1010198949 6:73266202-73266224 CAGAGTTTGTTATATAAGTCAGG - Intronic
1011830075 6:91361590-91361612 CAGATTGTCTAGTATATGTTGGG - Intergenic
1011961540 6:93096602-93096624 CAAAGTTTCTCCTATAATTCAGG - Intergenic
1012727972 6:102840719-102840741 CAGAGTTTGTGGTATAAGGTTGG - Intergenic
1015092926 6:129380368-129380390 GAGAATATTTACTATAAGTTAGG + Intronic
1015534117 6:134249663-134249685 GAGAGTTTCTATCATAAGCTTGG - Intronic
1016137075 6:140557108-140557130 TAGAATTTTTACTATAAATTCGG + Intergenic
1020380651 7:7541835-7541857 CTTAGTTTCTACTATATGTGAGG + Intergenic
1020490639 7:8779687-8779709 CAGAGATTCTAATATAAGGATGG - Intergenic
1023613365 7:41993640-41993662 CTGAGTTCCTACTATAGGCTGGG - Intronic
1025048749 7:55715909-55715931 CAGAGTATCTATTATTTGTTGGG + Intergenic
1026194264 7:68158903-68158925 CAGAATTTGTACAATAAGGTAGG + Intergenic
1026997885 7:74630812-74630834 CAGAGTATGAATTATAAGTTAGG - Intergenic
1029849568 7:103447700-103447722 CAGTGTTGCTACTCAAAGTTTGG - Intergenic
1030100709 7:105942739-105942761 CATAGTTTGTATTATAAGTGGGG + Intronic
1033812496 7:145032606-145032628 CACAGGTCATACTATAAGTTGGG - Intergenic
1034934521 7:155190224-155190246 TAGAGCTTCAACTATAAATTTGG - Intergenic
1039143409 8:34418544-34418566 TAGAGTTTCTAATACAGGTTGGG + Intergenic
1042236173 8:66614938-66614960 CAGAGCTTCTGCTATATTTTAGG + Intergenic
1042291813 8:67176736-67176758 CATAGTGTCTACTGGAAGTTGGG - Intronic
1042994337 8:74678808-74678830 CAGACTTTCAACTATGAGATTGG - Intronic
1044023481 8:87137903-87137925 CAGAGTTTCTGCCATAATTATGG + Intronic
1044768784 8:95606733-95606755 CTGAGTTTCTTCTCTAAGATGGG + Intergenic
1046594832 8:116248974-116248996 CAGAGCTTCTGCTATCAATTGGG + Intergenic
1052896143 9:33750196-33750218 CAGTTTTTCTAGTTTAAGTTTGG - Intergenic
1053168991 9:35864994-35865016 CAGAGTTTGAACTTTAAATTGGG - Intergenic
1056045917 9:82715706-82715728 CAGAGTTGTTACAGTAAGTTGGG - Intergenic
1058396785 9:104562912-104562934 TAGAGTTTCTAGTTTAATTTTGG - Intergenic
1058536176 9:105962457-105962479 CAGATTTTCTACTTTGAGTCAGG + Intergenic
1060537783 9:124405165-124405187 CTGAGTTCCTACTATAGATTAGG - Intronic
1060780138 9:126405658-126405680 CAGAGTTTCAATTATTAATTGGG + Intronic
1061602096 9:131677103-131677125 CAAAGTTTCTACTATGTGCTAGG + Intronic
1185954522 X:4474980-4475002 CAAAGTTTCACCTATAATTTGGG - Intergenic
1186219713 X:7336475-7336497 CAGAGTTTCTCCTTTAAGTCTGG + Intronic
1187110323 X:16292006-16292028 CATAGTTTCTAGCATAAGTTGGG - Intergenic
1189271006 X:39751906-39751928 CAGAGATTCTCCTAGCAGTTAGG - Intergenic
1189711752 X:43819872-43819894 CAGACTTTCTTCTCTCAGTTTGG - Intronic
1189951078 X:46231433-46231455 CAGAGGATCTACTATGTGTTAGG + Intergenic
1190226488 X:48549799-48549821 CTGAGTTTCTCCTATTACTTTGG + Intronic
1193610751 X:83629314-83629336 CAGAGATTCTTCTTTAAGCTTGG + Intergenic
1194256271 X:91638725-91638747 CAGATATTCTCCAATAAGTTAGG - Intergenic
1195940235 X:110161732-110161754 CAGTGTTTCTCCTATATGGTTGG + Intronic
1196346896 X:114672736-114672758 TAGAGTTTCAAATATAACTTTGG + Intronic
1197231943 X:124014694-124014716 TAGATTTCCTACTATTAGTTAGG + Intronic
1197286859 X:124605785-124605807 CACAGTTTCTATTATATGTGAGG + Intronic
1200575001 Y:4878009-4878031 CAGATATTCTCCAATAAGTTAGG - Intergenic
1201589155 Y:15594606-15594628 CATAGTTTCTCCTTTAAGTCTGG + Intergenic