ID: 1173429668

View in Genome Browser
Species Human (GRCh38)
Location 20:42975707-42975729
Sequence TTCTGGAGGCTATAGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 8, 3: 14, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173429663_1173429668 -7 Left 1173429663 20:42975691-42975713 CCAGCCAACACTACTTTTCTGGA 0: 1
1: 0
2: 3
3: 19
4: 162
Right 1173429668 20:42975707-42975729 TTCTGGAGGCTATAGATGGGTGG 0: 1
1: 0
2: 8
3: 14
4: 223
1173429661_1173429668 15 Left 1173429661 20:42975669-42975691 CCAAGCGGGGGCAGCTAAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1173429668 20:42975707-42975729 TTCTGGAGGCTATAGATGGGTGG 0: 1
1: 0
2: 8
3: 14
4: 223
1173429656_1173429668 28 Left 1173429656 20:42975656-42975678 CCACTACCAATTTCCAAGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1173429668 20:42975707-42975729 TTCTGGAGGCTATAGATGGGTGG 0: 1
1: 0
2: 8
3: 14
4: 223
1173429659_1173429668 22 Left 1173429659 20:42975662-42975684 CCAATTTCCAAGCGGGGGCAGCT 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1173429668 20:42975707-42975729 TTCTGGAGGCTATAGATGGGTGG 0: 1
1: 0
2: 8
3: 14
4: 223
1173429654_1173429668 29 Left 1173429654 20:42975655-42975677 CCCACTACCAATTTCCAAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1173429668 20:42975707-42975729 TTCTGGAGGCTATAGATGGGTGG 0: 1
1: 0
2: 8
3: 14
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173429668 Original CRISPR TTCTGGAGGCTATAGATGGG TGG Intronic
901574658 1:10191255-10191277 TTCTGCAGGCTGTACAAGGGTGG + Intergenic
902276099 1:15340624-15340646 GTCTGGAGGCAAAATATGGGCGG + Intronic
905079281 1:35302895-35302917 CTCTGGAGGCTGGAGGTGGGAGG + Intronic
907045828 1:51299521-51299543 TTCTGGAGATTAGAAATGGGTGG + Intronic
907834763 1:58098359-58098381 TTCTGGACCCTAGAGAAGGGTGG + Intronic
908042164 1:60126413-60126435 TTTGGGAGGCTGAAGATGGGGGG - Intergenic
908981355 1:69963060-69963082 TTCGGGAGGCTGAAGGTGGGCGG + Intronic
909033187 1:70566506-70566528 CTCTGGAGGCTTTAGTGGGGAGG - Intergenic
910375421 1:86563988-86564010 TTCTGGAGGCTATGGTAGAGAGG - Intronic
912775661 1:112504887-112504909 TTCTGGAGGATAGAGCAGGGTGG + Intronic
912828142 1:112924896-112924918 TTCTGAAGGATATATTTGGGTGG - Intronic
913410081 1:118541973-118541995 GTCTGGAGGCTCCAGTTGGGAGG - Intergenic
913649776 1:120901641-120901663 TTCTGGAGGCTAGAAGTGTGAGG - Intergenic
914076908 1:144361887-144361909 TTCTGGAGGCTAGAAGTGTGAGG + Intergenic
914102270 1:144604618-144604640 TTCTGGAGGCTAGAAGTGTGAGG - Intergenic
914171357 1:145227456-145227478 TTCTGGAGGCTAGAAGTGTGAGG + Intergenic
914296628 1:146332578-146332600 TTCTGGAGGCTAGAAGTGTGAGG + Intergenic
914526466 1:148471422-148471444 TTCTGGAGGCTAGAAGTGTGAGG + Intergenic
914639938 1:149595700-149595722 TTCTGGAGGCTAGAAGTGTGAGG - Intergenic
915309578 1:155000583-155000605 TTCCAGAGGCAATAGAAGGGCGG - Intergenic
916819060 1:168380570-168380592 CTCAGGAGGCCATAGGTGGGAGG - Intergenic
923321064 1:232833929-232833951 TCCTGGAGGGAAGAGATGGGTGG + Intergenic
923684757 1:236146355-236146377 GTCTGGAGGCTGAAGCTGGGTGG + Intronic
924877647 1:248122790-248122812 TTGCGGAGGCTGTAGATGAGGGG - Intergenic
924879635 1:248146006-248146028 TTGCGGAGGCTGTAGATGAGGGG - Exonic
924882789 1:248180844-248180866 TTGCGGAGGCTGTAGATGAGGGG - Exonic
924884893 1:248203926-248203948 TTGCGGAGGCTGTAGATGAGGGG - Exonic
924887919 1:248239787-248239809 TTGCGGAGGCTATAAATGAGAGG - Exonic
924894686 1:248323688-248323710 TTGCGGAGGCTATAAATGAGAGG + Exonic
1062863535 10:829458-829480 TGCTGGGGGCTGTACATGGGAGG + Exonic
1062974858 10:1675591-1675613 TTCTGGAGGCTTGGGTTGGGGGG + Intronic
1063647302 10:7897901-7897923 TTTGGGAGGCTGGAGATGGGAGG - Intronic
1067110903 10:43399186-43399208 TTGGGGAGGCTAAAGGTGGGAGG - Intronic
1067408818 10:46047087-46047109 TTCTGGAGACTAGAAATGTGAGG + Intergenic
1067828982 10:49599049-49599071 TTTGGGAGGCTGAAGATGGGAGG - Intergenic
1069174961 10:65279482-65279504 TTCTGGAGCCTGGAGAAGGGTGG - Intergenic
1069714164 10:70509933-70509955 ATCTGGACGAGATAGATGGGTGG - Intronic
1070155831 10:73834705-73834727 TTCTGGAGGCCTTGGCTGGGAGG - Intronic
1070920858 10:80185213-80185235 TTCTGGGGGCAGTAGATGGTAGG - Intronic
1071704548 10:87983063-87983085 TTCTGGAGGTGATAGAGAGGTGG - Intergenic
1073862972 10:107768920-107768942 TTCTGGAGGCCAGATTTGGGAGG + Intergenic
1074799291 10:116982852-116982874 CTCTGGAGGCTTGAGGTGGGAGG + Intronic
1075814831 10:125256917-125256939 CTCGGGAGGCTAAAGGTGGGAGG - Intergenic
1076465666 10:130679855-130679877 TTCTGCAGGCTATAGAAGCATGG - Intergenic
1080044480 11:27794872-27794894 TTCTGCAGGCTATACAAGGATGG + Intergenic
1080749686 11:35140234-35140256 TTGTGGTGGCTATGGAGGGGAGG + Intronic
1081006871 11:37755336-37755358 TTCTGGTGGCTATATGTGGAAGG + Intergenic
1081069666 11:38595454-38595476 TTCTGGAGGCTCTACAAGTGGGG - Intergenic
1082025702 11:47569947-47569969 TTTGGGAGGCTTGAGATGGGAGG + Intronic
1082696769 11:56376482-56376504 TTCTGGAGGCTATAGATTAAGGG - Exonic
1082862046 11:57866357-57866379 TTGCGGAGGCTATAGATGAAGGG + Intergenic
1084075030 11:66767897-66767919 CTCAGAAGGCTATAAATGGGAGG - Intronic
1084690976 11:70726415-70726437 GTCAGGAGGCTAGAGATGTGGGG + Intronic
1085001068 11:73035409-73035431 TTCGGGAGGCCAAAGGTGGGTGG - Intronic
1085513707 11:77100462-77100484 TTCTGGAGGCCGAAGGTGGGGGG - Intronic
1086259726 11:84924466-84924488 TTCTGCAGGCTCCAGAGGGGAGG - Intronic
1087322130 11:96676128-96676150 TTCTGGGGGCTATGGAGGCGGGG + Intergenic
1089081484 11:115779881-115779903 CTCAGGAGGCAAGAGATGGGAGG - Intergenic
1090150296 11:124376926-124376948 TTCCTGAGGCTATAAATGAGGGG + Intergenic
1090293648 11:125568039-125568061 TTTGGGAGGCTGTAGGTGGGCGG + Intergenic
1090301933 11:125649617-125649639 TTGGGGAGGCTTTAGGTGGGAGG + Intronic
1090521356 11:127482995-127483017 TTCTGCAGGCTATACAAGGATGG + Intergenic
1093201565 12:16193096-16193118 GTCTGGAGGCAGTAGATGGAGGG + Intronic
1093943559 12:25082201-25082223 TTCTGGAAGTCATGGATGGGAGG + Intronic
1095893006 12:47252169-47252191 TCCTGAAGGCAATAGATGGTTGG - Intergenic
1096007092 12:48182590-48182612 GTGTGGAGGGTATGGATGGGGGG - Intergenic
1096028944 12:48394523-48394545 TTCTTGAGGCTGCAGATGAGTGG + Intergenic
1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG + Intergenic
1099345996 12:81500324-81500346 ATGTGGAGGCTAAAGTTGGGAGG - Intronic
1100891635 12:99132187-99132209 CTCTGGAGGCTGTAGAAAGGTGG + Intronic
1102662333 12:114540161-114540183 TTCTTGTGGCTATAGATCTGAGG - Intergenic
1102665397 12:114568145-114568167 TTCTTGTGGCTATAGATCTGAGG + Intergenic
1106054086 13:26222071-26222093 TGCTGGAGGCTGTGGTTGGGAGG + Exonic
1106059380 13:26272247-26272269 TTCGGGAGGCTTGAGATGGGAGG + Intronic
1107012884 13:35685357-35685379 TTCTGGAGGCTGAGGCTGGGAGG - Intergenic
1107668721 13:42720189-42720211 TTGAGGAGGCTATGGAAGGGGGG - Intergenic
1109116146 13:58388607-58388629 TTCAGGAGGAAGTAGATGGGAGG - Intergenic
1114033849 14:18602020-18602042 TTCTGGAGGCTATAGATAAGGGG - Exonic
1114078643 14:19181194-19181216 TTCTGGAGGCTATAGATAAGGGG - Intergenic
1114124796 14:19712991-19713013 TTCTGGAGGCTATAGATAAGGGG + Intergenic
1114349037 14:21829652-21829674 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1114353280 14:21878339-21878361 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1114359102 14:21950232-21950254 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1114487699 14:23073211-23073233 TTATGCAGGGTAGAGATGGGGGG - Intronic
1117778672 14:59208984-59209006 TTCTGCAGGCTGTACATGGATGG - Intronic
1118091010 14:62478206-62478228 TGCTGGAGGTTATAGAAGAGGGG - Intergenic
1119234762 14:73010220-73010242 TTTTGGAGGCCAGAGGTGGGAGG + Intronic
1120515620 14:85466032-85466054 TTCTGGAGGCTATACAAGCATGG - Intergenic
1121561188 14:94877227-94877249 TTGGGGAGGCTATACATGTGTGG - Intergenic
1123568259 15:21574280-21574302 TTCTGGAGGCTATAGATAAGGGG + Intergenic
1123604367 15:22009602-22009624 TTCTGGAGGCTATAGATAAGGGG + Intergenic
1123820191 15:24021758-24021780 TTCTGGAAGCTGTAGATGCAGGG + Intergenic
1126595704 15:50382650-50382672 TTCTGCAGGCTGTGGCTGGGAGG - Intergenic
1127221672 15:56887133-56887155 TGCTGGAGGCTGTTGCTGGGAGG + Intronic
1128350293 15:66883973-66883995 TTATGGAGGCAAAAGATGGATGG - Intergenic
1129769366 15:78193690-78193712 GTCTGGGGGCTACAGATGTGGGG - Intronic
1130397419 15:83515025-83515047 TTCTGGAGGCTCTAGGAGAGAGG - Intronic
1131269745 15:90939867-90939889 TTCGGGGGCCTATGGATGGGTGG - Intronic
1131368928 15:91863576-91863598 TTCTTGAAGCTATACATGCGTGG + Intronic
1202976616 15_KI270727v1_random:301368-301390 TTCTGGAGGCTATAGATAAGGGG + Intergenic
1133975955 16:10600083-10600105 TTCAGGAGGCTGAGGATGGGAGG + Intergenic
1134284246 16:12846340-12846362 TTCTGGATGCAATAGATGAGGGG + Intergenic
1136480349 16:30537701-30537723 TTTGGGAGGCCAAAGATGGGTGG - Intronic
1139282052 16:65779462-65779484 TTCTGGAGTCTAAAGATCTGGGG + Intergenic
1139459035 16:67107648-67107670 TTCTGGAGGAGAAAGATGGGTGG - Intergenic
1141257941 16:82420762-82420784 ATCTGCATGCTATAGATGAGAGG - Intergenic
1142933991 17:3311854-3311876 TTCTGGAGGCTGTAAATGACTGG - Intergenic
1143384015 17:6515712-6515734 TTCTGTAGGTTAGATATGGGTGG - Intronic
1144611508 17:16722435-16722457 TTGTGGAGGCTATGCATGTGTGG - Intronic
1144749104 17:17635947-17635969 TTAGGGGGGCTAGAGATGGGGGG - Intergenic
1148776898 17:50101118-50101140 TTGTGGGGGCTGTAGGTGGGAGG + Intronic
1150984613 17:70181777-70181799 TTCTGAAGGCTAGAGCTTGGAGG - Intergenic
1151534199 17:74729566-74729588 TGCTTGAGGCTAGAGGTGGGCGG - Intronic
1151895359 17:76976814-76976836 TTCTAGAGGCTAGAAATTGGGGG + Intergenic
1153240508 18:3027326-3027348 TTTTAGAAGCTATAGAGGGGAGG + Intergenic
1153243875 18:3054861-3054883 TTTGGGAGGCTGGAGATGGGTGG - Intergenic
1156077638 18:33300253-33300275 TTCTGCAGGCTATAGAAGCATGG - Intronic
1158714963 18:59870450-59870472 CTCTGGAGGCTGGAGATGGGAGG - Intergenic
1160138257 18:76293986-76294008 TCTTGTAGGCTATAGATGGTTGG + Intergenic
1160424790 18:78772520-78772542 TTCTGGAGGCTACTGATGTGAGG + Intergenic
1160926835 19:1550479-1550501 TTCTGGAGGGGATGGATGGGTGG - Intergenic
1161802909 19:6425729-6425751 AACTGGACGCTCTAGATGGGGGG - Intergenic
1162823751 19:13238404-13238426 TTCTGGAGCCCTTAGGTGGGTGG - Intronic
1163445512 19:17343802-17343824 TTTGGGAGGCCATAGGTGGGCGG + Intergenic
1164811281 19:31158497-31158519 TTCTGGAGGCTCTAGAATGGTGG + Intergenic
1165197541 19:34116655-34116677 CTCTGGAGGCTAGAGCTTGGGGG - Intergenic
1166936394 19:46335793-46335815 TTTGGGAGGCTATGGAGGGGAGG + Intronic
1167873071 19:52389652-52389674 TTCTGGGGTCTATAGGAGGGTGG + Intergenic
1168665335 19:58200851-58200873 TTCTGCAGGCTGTACAAGGGTGG + Intronic
932137788 2:69245708-69245730 TTCTAGAGGTGATAGATGGCTGG - Exonic
932436615 2:71705679-71705701 TTCTGAGGGCTGGAGATGGGTGG - Intergenic
933610902 2:84434116-84434138 TTCTGCAGGCTATACATGCATGG - Intronic
934029889 2:88033826-88033848 TTCTTTTGGCTATATATGGGTGG - Intronic
934978922 2:98824372-98824394 TTCAGGAGGCCAGAGAAGGGGGG - Intronic
937105890 2:119312354-119312376 CTCAGGAGGCTGGAGATGGGAGG - Intronic
943275251 2:185858784-185858806 TTCTGCAGGCTATACATGCATGG + Intergenic
944316798 2:198292943-198292965 TTCTGGTGGGCATAGAGGGGAGG + Intronic
945748257 2:213746237-213746259 TTCAGGCGGCTTTAGATGGATGG - Intronic
947295317 2:228624358-228624380 TTCTGGAGGATAAAGAGGGAAGG + Intergenic
948898665 2:240943987-240944009 TTCTAGTTGCTTTAGATGGGAGG + Intronic
1168908543 20:1426514-1426536 TTCTGGAGGCCAGAGGTAGGAGG + Intergenic
1169143153 20:3237376-3237398 TTCGGGAAGCTAGACATGGGCGG - Intronic
1173429668 20:42975707-42975729 TTCTGGAGGCTATAGATGGGTGG + Intronic
1174539789 20:51279930-51279952 TTCTGGAGGCTCCAGAAGAGAGG - Intergenic
1175587674 20:60157819-60157841 TACTGGAGCCTATTGAAGGGTGG + Intergenic
1177966830 21:27738141-27738163 TTCTGCAGGCTATACATGCATGG + Intergenic
1180457966 22:15529062-15529084 TTCTGGAGGCTATAGATAAGGGG - Exonic
1181065056 22:20301685-20301707 CTCTGGGGGCCAGAGATGGGGGG + Intergenic
1181906540 22:26201597-26201619 ATCTGGAGGCGGTAGAAGGGTGG + Intronic
1184998044 22:48224842-48224864 TGCGGGAGGCTTTAGATGTGGGG - Intergenic
949154032 3:807795-807817 TTCTGCAGGCTATACAAGTGGGG - Intergenic
949899574 3:8799263-8799285 TTTGGGAGGCCAAAGATGGGAGG + Intronic
952176188 3:30865916-30865938 TTTTGGAAGCTATGGAGGGGAGG - Intronic
952868113 3:37871552-37871574 TTCTGAAAGCTAAAGATGGTAGG - Intronic
953098646 3:39804327-39804349 TACTGGAGGGTAGAGAGGGGAGG + Intergenic
953264017 3:41368527-41368549 TGCTGGAGGCTATAGAGAGAGGG - Intronic
953920289 3:46946997-46947019 TTCAGGAAGCTAAAGAAGGGTGG - Intronic
954105964 3:48410046-48410068 TGCTGGAGGATGTAGATGAGGGG - Exonic
955122358 3:56073410-56073432 TTTTGGTTGCTATAGCTGGGAGG - Intronic
957262986 3:77923695-77923717 TTCTGCAGGCTATGGATAGCTGG + Intergenic
962906046 3:139803977-139803999 TTCTAGAGGCTAGAGATGGTGGG - Intergenic
964687446 3:159412860-159412882 GTCTGGAGGCAAGAGATGGGTGG + Intronic
964742337 3:159979901-159979923 ATCAGGAGGCTAAAGGTGGGAGG + Intergenic
964918829 3:161871293-161871315 TTCTGGATGATAAAGTTGGGAGG - Intergenic
965349668 3:167597513-167597535 TTCTGGAGTCTAGAGAATGGTGG - Intronic
968028944 3:195466366-195466388 TTCTGGAGGCTCTAGGGGAGAGG + Intergenic
970624015 4:17857403-17857425 TTCTGGAGGCTATATATAGCTGG + Intronic
972171697 4:36353420-36353442 TTCTTGAGGCTATCTTTGGGAGG - Intergenic
972788015 4:42345542-42345564 TTCAGCAGGCTACAGATGGAAGG + Intergenic
974080021 4:57202546-57202568 CTCAGGAGGCTGAAGATGGGAGG + Intergenic
976650468 4:87428811-87428833 TGCGGGAGGCTATGCATGGGTGG - Intronic
976826073 4:89261866-89261888 TTCGGGAGGCTGTAGGGGGGTGG + Intronic
977559500 4:98518136-98518158 TTTTGGAGGCTAAAGGGGGGAGG - Intronic
978936339 4:114381591-114381613 CTCTGGAGGCTCTAGCAGGGAGG - Intergenic
979141167 4:117176579-117176601 CTCTGGGGCCTATAGAAGGGTGG - Intergenic
980365571 4:131800097-131800119 TACTGGAGACTAAAGACGGGAGG + Intergenic
981102843 4:140849524-140849546 TTCTGGAGGCTAGAAGTTGGAGG + Intergenic
981169340 4:141604202-141604224 TTGTGAAGGCTATAGATGAGAGG - Intergenic
981769395 4:148290068-148290090 TTCTGGAGGCTAGAAATGCAAGG + Intronic
983976284 4:173938179-173938201 TTCTTGAGCTTATATATGGGTGG + Intergenic
984350625 4:178587724-178587746 TTTGGGAGGCTGGAGATGGGAGG + Intergenic
984402380 4:179282884-179282906 TTCTGGAAGCTATAGAAGTGTGG + Intergenic
984995908 4:185429776-185429798 CTCAGGAGGCTGAAGATGGGAGG - Intronic
985383323 4:189419058-189419080 TTCTGGAGGCTGTAGCTCGTCGG - Intergenic
987961315 5:24813153-24813175 TTTGGGAGGCTGGAGATGGGCGG - Intergenic
989981053 5:50644890-50644912 TTCTGGAGGCTAGAAGTGTGAGG - Intergenic
989995133 5:50820131-50820153 TTCTGGATGCTATGATTGGGTGG + Intronic
990259465 5:54005929-54005951 CTCAGGAGGCTGTAGCTGGGAGG + Intronic
990520926 5:56580142-56580164 TTCTGGAGCCCAAAGATGGCAGG - Intronic
991679827 5:69127744-69127766 TTCTGGAGGCTACAGATGTGTGG - Intronic
992615151 5:78540506-78540528 TTCTGAAGGCCATGAATGGGAGG - Intronic
994277376 5:97855239-97855261 GTCTGGAGGCCACAGTTGGGAGG - Intergenic
995093132 5:108204296-108204318 CTCTGGAGGCTTGAGGTGGGTGG - Intronic
997313147 5:132907242-132907264 TTCTACAGGCTGTAGAAGGGAGG - Intronic
999845434 5:155474419-155474441 TGAGGGAGGCTATAGATGTGTGG - Intergenic
1001894048 5:175363650-175363672 TTCTGGGGGCTGTAGGTAGGTGG - Intergenic
1005380984 6:25234177-25234199 TTTGGGAGGCTGTAGGTGGGAGG - Intergenic
1011947733 6:92927833-92927855 TTCTGCAGGCTATACAAGTGTGG - Intergenic
1013467025 6:110426705-110426727 TTCAGGAGGCTTGAGGTGGGTGG + Intronic
1015573580 6:134647386-134647408 TTCTGAAGGTTATAGCTAGGAGG + Intergenic
1016929099 6:149384669-149384691 TTTTGGAAGCTAGAGTTGGGTGG - Intronic
1016983285 6:149873336-149873358 CTCAGGAGGCTAAAAATGGGAGG - Intergenic
1017655166 6:156620654-156620676 TTCTGGAGGCTCTAGGGGGTGGG - Intergenic
1022614651 7:31916862-31916884 TTCTGGAGGCAATGGACTGGAGG + Intronic
1026743622 7:72994519-72994541 TTTGGGAGGCCAAAGATGGGAGG - Intergenic
1026783705 7:73285991-73286013 TTTGGGAGGCCAAAGATGGGAGG - Intergenic
1026803534 7:73415184-73415206 TTTGGGAGGCCAAAGATGGGAGG - Intergenic
1027029729 7:74879217-74879239 TTTGGGAGGCCAAAGATGGGAGG - Intergenic
1027100113 7:75370558-75370580 TTTGGGAGGCCAAAGATGGGAGG + Intergenic
1027428633 7:78086876-78086898 TTTGGGAGGCTAAAAATGGGTGG - Intronic
1028205606 7:88013154-88013176 TACTGGATGCTATAAATTGGTGG - Intronic
1029638764 7:101804790-101804812 TTCTGGCAGCTATGGCTGGGAGG - Intergenic
1029764623 7:102618274-102618296 TTTGGGAGGCTTGAGATGGGAGG + Intronic
1033184174 7:139210790-139210812 TTCTGGAGGCTGTAGACGAAGGG + Intergenic
1033729228 7:144158082-144158104 TTCCGCAGGCTGTAGATGAGGGG - Intergenic
1034825251 7:154256530-154256552 ATTTGGAGGCTACAGATAGGTGG - Intronic
1036674084 8:10815046-10815068 CTCAGGAGGCTGGAGATGGGAGG - Intronic
1041227731 8:55716983-55717005 AACTGGGGGCTATTGATGGGGGG + Intronic
1042032217 8:64488921-64488943 TTCTGCAGGCTACAGATGCATGG + Intergenic
1044705415 8:95003921-95003943 TTCTGGAGGTTACAGCTTGGAGG - Intronic
1045756622 8:105550813-105550835 TTCTGGAGGCTTCAGCTGTGTGG - Intronic
1047714249 8:127581103-127581125 TTATGGAGCTTATAGATGGTAGG + Intergenic
1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG + Intergenic
1051990353 9:23145336-23145358 TTCTGGGGTCTAGAGAAGGGTGG + Intergenic
1052161945 9:25273110-25273132 TTCTGCAGGCTGTATAAGGGTGG - Intergenic
1052334798 9:27308306-27308328 TTCTGGAAGATATAAATGAGGGG - Intergenic
1055337151 9:75244374-75244396 TACTTGAGGGTAGAGATGGGAGG - Intergenic
1055773912 9:79747660-79747682 CTCTGGAGGCTATGGATGTGGGG - Intergenic
1058407702 9:104695376-104695398 TTCCTGAGGCTATAGATGATGGG - Exonic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1058984768 9:110200452-110200474 TTCTGGTGGCTATGTCTGGGGGG - Exonic
1060078010 9:120612291-120612313 TTCTGGATGCTATAGGTGAAAGG - Intronic
1060342527 9:122789803-122789825 TTGCGGAGGCTGTAGATGAGTGG - Exonic
1062145742 9:134988729-134988751 TTCTGCAGGCTATACAAGCGTGG + Intergenic
1185452134 X:288304-288326 TTCTAGAGGCTCTAGAGTGGGGG + Intronic
1186929049 X:14367912-14367934 TTCTGGAGGCTATAAGTCTGAGG - Intergenic
1188826890 X:34846169-34846191 CTCAGGAGGCTGTAGATGTGTGG + Intergenic
1189854937 X:45214584-45214606 GACTGGAGGCCACAGATGGGAGG - Intergenic
1189968861 X:46397739-46397761 TTCTGGGGGATATAGATGATAGG - Intergenic
1194419070 X:93649948-93649970 TTCTGGAGGCTGGAGGAGGGTGG - Intergenic
1194806243 X:98331728-98331750 TTCTGGTGGGTAGAGATGGATGG - Intergenic
1195711081 X:107774530-107774552 TTCTTGAGCCTCTGGATGGGAGG - Intronic
1195850038 X:109273033-109273055 TTCTGGAGATGATAGCTGGGTGG - Intergenic
1195989516 X:110668631-110668653 TTCTGGATGGGATGGATGGGAGG - Intergenic
1196799466 X:119529736-119529758 ATCTGTTGGCTATAGATGCGTGG + Intergenic
1197494748 X:127164065-127164087 TTCCAGAGGCTACAGATGGTAGG + Intergenic