ID: 1173430435

View in Genome Browser
Species Human (GRCh38)
Location 20:42982924-42982946
Sequence ACTACCTCCCACATACCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173430431_1173430435 13 Left 1173430431 20:42982888-42982910 CCCAACTTCTTATAATCTATCCA No data
Right 1173430435 20:42982924-42982946 ACTACCTCCCACATACCTTACGG 0: 1
1: 0
2: 0
3: 3
4: 78
1173430432_1173430435 12 Left 1173430432 20:42982889-42982911 CCAACTTCTTATAATCTATCCAG 0: 1
1: 0
2: 1
3: 13
4: 215
Right 1173430435 20:42982924-42982946 ACTACCTCCCACATACCTTACGG 0: 1
1: 0
2: 0
3: 3
4: 78
1173430434_1173430435 -7 Left 1173430434 20:42982908-42982930 CCAGGTAGATATAATCACTACCT 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1173430435 20:42982924-42982946 ACTACCTCCCACATACCTTACGG 0: 1
1: 0
2: 0
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173430435 Original CRISPR ACTACCTCCCACATACCTTA CGG Intronic
900101826 1:965213-965235 GCAGCCTCCCACATGCCTTAAGG + Exonic
901290755 1:8122480-8122502 ACTAACAACCACATACCTAAAGG + Intergenic
902524391 1:17046274-17046296 ACTTCCTCCCAAATACCACAAGG - Intronic
908483421 1:64566489-64566511 AGTACTTCCCCCATACCTTGTGG - Intronic
908715283 1:67063394-67063416 GCTACCTCCACGATACCTTATGG - Intergenic
909061724 1:70886491-70886513 ACTATCTCCCAGATACCACAAGG + Intronic
911584344 1:99673049-99673071 GCCACATCCCACATAACTTAAGG + Intronic
914459620 1:147871264-147871286 ACTACCTCCTACATGCCATGTGG + Intergenic
917444635 1:175096731-175096753 ACTACCTACCTCATAGGTTATGG - Intronic
918525186 1:185456919-185456941 CCTCCCTCCCTCATACCTTTTGG + Intergenic
1063131121 10:3178262-3178284 AGTTCCCCCCACCTACCTTAAGG + Intergenic
1064348411 10:14554227-14554249 AATACTTCCCACCTACCTTATGG + Intronic
1064625948 10:17261469-17261491 TCTCCCTCCCACAGAACTTATGG + Intergenic
1065323350 10:24529293-24529315 ACATCCTCCCATATACTTTACGG + Intronic
1070418736 10:76214943-76214965 ACCACCTGCCACATAACTAATGG + Intronic
1072391837 10:94995083-94995105 ACTACATCACACATGCCTTGGGG + Intergenic
1085087012 11:73675208-73675230 AATAGCTGCCACAGACCTTATGG - Intergenic
1088221847 11:107577947-107577969 ACTACCCTCCAAATACCTGATGG - Intergenic
1088230653 11:107670457-107670479 GCAACATCCCACAGACCTTAGGG - Intergenic
1095126448 12:38483897-38483919 ACTACCTCCAAAATACTTTCTGG + Intergenic
1096340320 12:50792836-50792858 CCTACCTACCACATGCTTTATGG + Intronic
1099759728 12:86902997-86903019 ACTACCTCCACAATAACTTAGGG + Intergenic
1099924068 12:88996069-88996091 ACAACCTGCCACATGCCTTTTGG - Intergenic
1100140954 12:91618260-91618282 TCAACTTTCCACATACCTTAAGG - Intergenic
1101718736 12:107333114-107333136 ACCCCCTCCCTCATTCCTTATGG + Intronic
1106570360 13:30921861-30921883 ACTACCTTCCACATATCCTTCGG - Intronic
1109977752 13:69862434-69862456 AGTATTTCTCACATACCTTAAGG - Intronic
1111619673 13:90707473-90707495 ACTACAACACACATAACTTATGG - Intergenic
1113241148 13:108338818-108338840 CCACCCTCCCACATAACTTAAGG - Intergenic
1115472213 14:33779531-33779553 ACTACCTACCACATATATGATGG + Intronic
1119634828 14:76265248-76265270 ACTCCCTTCCTCATCCCTTAAGG - Intergenic
1121000201 14:90446398-90446420 AGTACCTCCCACCTACAATAAGG - Intergenic
1128892750 15:71345318-71345340 ACTCCCTCCTACATACCCTCTGG - Intronic
1131917567 15:97286817-97286839 GATACCTACCACATACCTGAGGG - Intergenic
1135491491 16:22913352-22913374 GCTTCCTCCCACATCCCTTAAGG + Intronic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1140323456 16:73976899-73976921 ACTATCTCCCACATTTGTTAAGG + Intergenic
1141696774 16:85623997-85624019 TCTCCCTCCCACTTACCTGAGGG + Intronic
1146986167 17:37220635-37220657 TCTACCTCAAAAATACCTTATGG - Intronic
1150966396 17:69974182-69974204 TCTACTTCCCACATAACTTCAGG + Intergenic
1153784069 18:8518651-8518673 ACTACCTCCCCCAATCCCTATGG - Intergenic
1157881035 18:51321238-51321260 AGTACCTGCCACATACCAAAGGG + Intergenic
1158342146 18:56478022-56478044 AGTTACTACCACATACCTTAAGG + Intergenic
1158613983 18:58969057-58969079 CCTACCTCCCAGTTACCTTCTGG - Intronic
1158830942 18:61277838-61277860 ACTCCCTCCCTCACACCTTTTGG - Intergenic
928390018 2:30902436-30902458 ACTACCCTCCACATCCTTTAAGG + Intergenic
928642733 2:33317764-33317786 AATAACTCCCACATAGCTGAAGG + Intronic
928855424 2:35797203-35797225 ACTACCTGCCACATGCCTGTGGG - Intergenic
934680172 2:96278054-96278076 ATTACCACCCACATGCCTCAGGG - Intronic
935972334 2:108542335-108542357 ACTTCCACACAAATACCTTAAGG + Intronic
939145062 2:138403695-138403717 ACTGCCTTCCACATTCCTTCTGG - Intergenic
943182736 2:184563910-184563932 ATAACCACCCACACACCTTATGG + Intergenic
943579048 2:189662646-189662668 GCTACCTCACACACACCTCAGGG - Intronic
1168932262 20:1633714-1633736 GGTTCCTCCCACATACCTTATGG - Intronic
1171021911 20:21592203-21592225 ACTACCTCCCTCATAACTAGTGG - Intergenic
1173430435 20:42982924-42982946 ACTACCTCCCACATACCTTACGG + Intronic
1177662498 21:24104155-24104177 AGTATCTCACACATATCTTAGGG + Intergenic
1178439428 21:32586396-32586418 ACAACCTCTCACACACCTCAGGG - Intronic
1183567887 22:38629517-38629539 ACTACCTACCACATAGATTGTGG - Intronic
954126712 3:48535465-48535487 TCTACCTCCCAGATACCGCAGGG - Intronic
961209533 3:125115040-125115062 ACTCCCTTCCACACTCCTTATGG - Intronic
975912519 4:79283938-79283960 ATTACCTGCCACAGAGCTTAGGG + Intronic
985380131 4:189385004-189385026 ACTACCCCCCACATAAATTCAGG - Intergenic
997911215 5:137875554-137875576 ACTTACTCTCACATTCCTTAGGG + Intronic
1001500503 5:172229018-172229040 TCTACCTCCCATACCCCTTAAGG + Intronic
1002406529 5:179037983-179038005 ACTAGCTACCACATACATAAAGG + Intergenic
1004876495 6:19960196-19960218 ACTACCTCCCTATGACCTTAAGG - Intergenic
1015337824 6:132061590-132061612 CCTACCTCCCACATCCCGTTTGG - Intergenic
1021038220 7:15827934-15827956 GCTAACTGCCACTTACCTTAAGG - Intergenic
1031980254 7:128120095-128120117 TCTGCCACCCACATACCTGAAGG + Intergenic
1032503112 7:132414821-132414843 AAAACCTCCCACACACCTCATGG + Intronic
1034785330 7:153920991-153921013 ACAACCTCCCACAGAACTTCAGG - Intronic
1036161593 8:6393944-6393966 ACTTCCTCCCAAATATTTTAAGG - Intergenic
1054946440 9:70801176-70801198 TCTACCTTGCTCATACCTTAGGG + Intronic
1055196725 9:73603260-73603282 ACTACCTCCCACATTCCCATTGG - Intergenic
1058363752 9:104182833-104182855 ACTACCTCCCAAATGCACTAAGG - Intergenic
1058766909 9:108190619-108190641 TCTACCTCCCAAATACATCATGG - Intergenic
1060081301 9:120649054-120649076 ACGTCCTCCCAGATACTTTAAGG + Intronic
1062371748 9:136242837-136242859 TCTACCTCCCACAAGCCTCATGG + Intronic
1190566857 X:51739274-51739296 GCCACCTCCCCCATACCATAAGG + Intergenic
1196051753 X:111313041-111313063 ACTACCTCCCAGAGATGTTAGGG - Intronic
1196699644 X:118654019-118654041 ACTAACTACCACATACACTAAGG - Intronic