ID: 1173433567

View in Genome Browser
Species Human (GRCh38)
Location 20:43012793-43012815
Sequence ACTGGCCATCCCCATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173433567_1173433575 19 Left 1173433567 20:43012793-43012815 CCATCACCATGGGGATGGCCAGT 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173433575 20:43012835-43012857 AAATATCTCTTGCCTCCAGGTGG No data
1173433567_1173433574 16 Left 1173433567 20:43012793-43012815 CCATCACCATGGGGATGGCCAGT 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173433574 20:43012832-43012854 GCAAAATATCTCTTGCCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 168
1173433567_1173433570 -8 Left 1173433567 20:43012793-43012815 CCATCACCATGGGGATGGCCAGT 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173433570 20:43012808-43012830 TGGCCAGTGGACCTCCATGAAGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173433567 Original CRISPR ACTGGCCATCCCCATGGTGA TGG (reversed) Intronic
900325849 1:2108313-2108335 CCTGGCCTTCTCCATGCTGATGG + Intronic
901024584 1:6272466-6272488 CTTGGCCATCCCCCTGGAGATGG + Intronic
901210821 1:7525112-7525134 CCTGGCCAGCCCCCTGGAGAGGG - Intronic
901469214 1:9443950-9443972 ACGGGCTGTGCCCATGGTGAAGG - Intergenic
901769272 1:11522305-11522327 CCTGGCCTTCCCCTTGGTAATGG + Intronic
902068033 1:13705588-13705610 ACGGGCCATCAACATGGAGATGG - Exonic
902515702 1:16988348-16988370 ACTGGCCATGCTCGAGGTGAAGG + Exonic
902921127 1:19666424-19666446 ACTGGCCATGCCGGTGGTGAGGG - Exonic
903025014 1:20422042-20422064 AGTGGCCATCTCACTGGTGAGGG - Intergenic
904355978 1:29940131-29940153 GATGACCAACCCCATGGTGATGG + Intergenic
905365207 1:37447674-37447696 ACTGGCCATGCCCCTGCTGGAGG + Intergenic
912684358 1:111750219-111750241 TCAGGCAATCCCCATGGTGGGGG + Intronic
913958676 1:143323384-143323406 ACTGGCCCTGCCAATGGTCATGG - Intergenic
914052993 1:144148764-144148786 ACTGGCCCTGCCAATGGTCATGG - Intergenic
914126204 1:144817777-144817799 ACTGGCCCTGCCAATGGTCATGG + Intergenic
915051933 1:153084330-153084352 AATGGCCATCACCAGGGAGAAGG - Intergenic
915303023 1:154962131-154962153 ACACGACATCCCCATGGGGACGG + Intronic
917273708 1:173306647-173306669 AGTGGCCATCTCCATGGAGGAGG - Intergenic
918780284 1:188690855-188690877 CCTGCCCACCACCATGGTGATGG - Intergenic
919862719 1:201752244-201752266 ACTGATCCCCCCCATGGTGAGGG + Intronic
922562945 1:226582194-226582216 ACCAGTCATCCCAATGGTGAAGG - Intronic
924392815 1:243581250-243581272 ACTGCCCAGCCCCAGGGTCAGGG - Intronic
1073274698 10:102299975-102299997 ACTGACCATACCCATGCAGATGG - Intronic
1073319483 10:102605881-102605903 CCTGGGCATCCCCAAGGAGAAGG + Intronic
1078453128 11:11455026-11455048 CCTGCCCATCCCCAGGGTGCGGG + Intronic
1080146095 11:28985854-28985876 ACTGGCCATCCCCTGAGTGAGGG + Intergenic
1083602614 11:63958314-63958336 AATGGCCATCCCCTTGCTGAAGG + Intergenic
1083612635 11:64011413-64011435 ACTGGCAGTCCCCAGGGTGAGGG + Intronic
1085509645 11:77081807-77081829 CCAGGCCTTCCCCAGGGTGAAGG + Intronic
1087721761 11:101673346-101673368 ACGGGCCCTGCCCATGCTGAGGG - Intronic
1088409802 11:109521727-109521749 ACTGGCCAGCAACATGTTGAAGG - Intergenic
1089626533 11:119754724-119754746 ACTGCCCATCCCCTTGGCCAGGG + Intergenic
1090088167 11:123669735-123669757 ACTGGCATTCCCCATGGTGATGG + Intergenic
1096977540 12:55707993-55708015 CCTGGGCATCCCCTTGGAGACGG - Intronic
1097266633 12:57749362-57749384 ACTGGCTCTGCCCATGGGGATGG - Intronic
1097494337 12:60311888-60311910 ACTGACCATACCCAAAGTGAAGG + Intergenic
1098357608 12:69626424-69626446 ACATGCCATCACCATGCTGAGGG + Intergenic
1102033670 12:109759059-109759081 ACTGGGCATACCCCTGGAGAAGG - Intronic
1102076896 12:110066897-110066919 GCTGGCCGTCGCCATGGAGATGG - Intronic
1103453444 12:121046113-121046135 TCTGGCCTTCCCCTTGGTTATGG + Intergenic
1103910188 12:124347996-124348018 AGTGGTCATCCCCACGATGATGG + Intronic
1105929922 13:25042628-25042650 ACCTGCCCTTCCCATGGTGAGGG - Intergenic
1106598880 13:31170454-31170476 ACTGGCCTTTCCAATGGGGAGGG + Intergenic
1107875251 13:44785000-44785022 ATTTGCCATTCCCATGATGAAGG + Intergenic
1114552807 14:23543624-23543646 ACTGGCCATGCCCTGTGTGAAGG + Intronic
1117294070 14:54362857-54362879 TCTGTCCATTCCCATGCTGACGG - Intergenic
1122034684 14:98938733-98938755 AATGGAAATCCCAATGGTGAAGG - Intergenic
1202929731 14_KI270725v1_random:26808-26830 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1123422570 15:20144436-20144458 ACTGGCCCTGCCAATGGTCATGG - Intergenic
1123442443 15:20301928-20301950 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1123531798 15:21150976-21150998 ACTGGCCCTGCCAATGGTCATGG - Intergenic
1125891620 15:43270890-43270912 ACTGGCCTGCCCCATGCGGATGG - Intergenic
1128092535 15:64928745-64928767 GCTGGACATCCCCAAGGTGGAGG + Intronic
1129044197 15:72719146-72719168 ACTGGCCACCCCCATGATCCTGG - Intronic
1129114030 15:73355013-73355035 TCTGGCCATCCCCAGCCTGAGGG - Intronic
1131138537 15:89958326-89958348 TCTGGCCAGCCCCATGGTAAGGG - Intergenic
1131938298 15:97532515-97532537 AGTGGCCATTCCTATGGGGAGGG - Intergenic
1133023466 16:2976999-2977021 ACTGGCCATGCCCATGCCCACGG - Exonic
1133409894 16:5559497-5559519 ACAGGCCTTCCCCATTGTGTGGG - Intergenic
1134467515 16:14492446-14492468 ACCTGCCCTCACCATGGTGAGGG - Intronic
1136718776 16:32303616-32303638 ACTGGCCCTGCCAATGGTCATGG - Intergenic
1136837147 16:33509880-33509902 ACTGGCCCTGCCAATGGTCATGG - Intergenic
1136862182 16:33710924-33710946 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1141009294 16:80382402-80382424 CCTGACCCTCCCCACGGTGATGG + Intergenic
1141464661 16:84197619-84197641 TCTGGGCAGCCCCATGTTGAAGG + Intergenic
1141753502 16:85975586-85975608 CCCGGCCAACCCCAGGGTGAGGG + Intergenic
1203007655 16_KI270728v1_random:214155-214177 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1203123676 16_KI270728v1_random:1559107-1559129 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1203147323 16_KI270728v1_random:1810159-1810181 ACTGGCCCTGCCAATGGTCATGG - Intergenic
1143087564 17:4427544-4427566 CCTGGCCATCCCCATTTTGTAGG + Intergenic
1143910441 17:10244534-10244556 AGAGGTCATCCCCACGGTGAGGG - Intergenic
1146479184 17:33190814-33190836 ACTGACCATCCCAAGGGTCAGGG + Intronic
1146946976 17:36880125-36880147 CCAGGCCTTCCCCTTGGTGAGGG - Intergenic
1148646497 17:49222468-49222490 ACCGTGCATCCCCATGGTGGTGG + Intronic
1148758088 17:49985110-49985132 ACTGTCCCTCCCCAGGCTGATGG - Intergenic
1148858887 17:50593793-50593815 ACTGCCCACTCCCATGGAGAGGG - Intronic
1148931748 17:51132508-51132530 GTTGGTCATCCCCCTGGTGATGG - Intergenic
1150711311 17:67532900-67532922 ACTGCCCATTGCCATGGTGAGGG - Exonic
1151815722 17:76470503-76470525 ACTGGCCATCCTCAGTGTGGTGG + Intergenic
1153804077 18:8696856-8696878 AATGGTCAGCCCCACGGTGATGG - Intergenic
1154415667 18:14174105-14174127 ACTGGCCCTGCCAATGGTCATGG - Intergenic
1155690437 18:28615610-28615632 AGTGACAATCTCCATGGTGATGG - Intergenic
1157946273 18:51984263-51984285 AGTTGCCATGCCCAGGGTGATGG + Intergenic
1162301833 19:9848938-9848960 ACTGGCAATAAACATGGTGACGG + Intronic
1163163494 19:15479739-15479761 CCTGTCCCTCCCCATAGTGACGG + Exonic
1163849135 19:19653739-19653761 ACGGGCCAGGCACATGGTGAAGG + Intronic
1164181056 19:22819175-22819197 ACTGGGCATCACCTTGGTGCTGG - Intergenic
1164567760 19:29340076-29340098 TCTGGCCATACCCTGGGTGACGG - Intergenic
1164762996 19:30742388-30742410 ACTGAGCATCACCATGGTTAGGG + Intergenic
1165147643 19:33741811-33741833 GCTGGCATTCCCTATGGTGACGG + Intronic
1168432442 19:56292038-56292060 ACTGGGCATCCCAGTGGTGACGG + Intronic
1168486952 19:56771427-56771449 TCTGGCCCTCCCTATGCTGAGGG + Intergenic
1202692389 1_KI270712v1_random:101187-101209 ACTGGCCCTGCCAATGGTCATGG - Intergenic
926909860 2:17842553-17842575 AGTGGCCAGCCCCATTGAGAAGG + Intergenic
927718274 2:25366714-25366736 ACTGGGCCACCCCATAGTGATGG - Intergenic
931791341 2:65666653-65666675 CCTGGCCATCCCCACGGCCAGGG - Intergenic
933954006 2:87352784-87352806 ACTGGCCCTGCCAATGGTCATGG + Intergenic
934238211 2:90249027-90249049 ACTGGCCCTGCCAATGGTCATGG + Intergenic
934274988 2:91567706-91567728 ACTGGCCCTGCCAATGGTCATGG - Intergenic
934460630 2:94212366-94212388 ACTGGCCCTGCCAATGGTCATGG + Intergenic
935625613 2:105169944-105169966 ACTGGAGATCCCAATGGGGAGGG + Intergenic
938370160 2:130763580-130763602 GCTGACGATGCCCATGGTGATGG - Exonic
942451685 2:176112293-176112315 ACAGGCCCTCCCCAAGGTCAGGG - Intronic
944654389 2:201863510-201863532 ACTGGCCATAAACATGGAGAAGG - Intronic
945014824 2:205504177-205504199 ACTGGCCAGCCATATGGAGAAGG + Intronic
945668907 2:212778656-212778678 CCTGGCCATCCCCCTGGCTATGG - Intergenic
947888797 2:233597208-233597230 GCTGTGCATACCCATGGTGAGGG - Intergenic
948165923 2:235862546-235862568 ACTGCCCTACCCCATGGTGATGG - Intronic
1169070943 20:2730025-2730047 GCCGGCCAGCCCTATGGTGAGGG + Intronic
1169540305 20:6592543-6592565 TCTTGCCTTCCCCATGGTAATGG - Intergenic
1170069379 20:12348293-12348315 ATTGGCAATCCTCATGGTAAAGG - Intergenic
1170570739 20:17630993-17631015 AGTGGCCACCTCCTTGGTGATGG - Intronic
1173433567 20:43012793-43012815 ACTGGCCATCCCCATGGTGATGG - Intronic
1176591753 21:8655407-8655429 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1176857669 21:13985199-13985221 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1176866938 21:14059028-14059050 ACTGGCCCTGCCAATGGTCATGG - Intergenic
1179732435 21:43375222-43375244 CCTGGCCATCCACATGCTCAGGG + Intergenic
1179912919 21:44459814-44459836 TCTGGCCTTCTCCTTGGTGAAGG + Exonic
1180274600 22:10632519-10632541 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1180859367 22:19068552-19068574 ATGGGCCATCCCCATGGGGCTGG - Intronic
1181355617 22:22294389-22294411 ACTGGCCCTGCCAATGGTCATGG - Intergenic
1181365991 22:22377482-22377504 ATTGGCCATTCCCATGGAAATGG + Intergenic
1181456616 22:23063635-23063657 GCTGGCCTTCCTCATGGGGAGGG + Intronic
1181816091 22:25437842-25437864 ACAGCCCAGCCCCATTGTGAGGG - Intergenic
1181946543 22:26522061-26522083 ACTTAACAGCCCCATGGTGAAGG - Intergenic
1184010725 22:41746005-41746027 GCTGTGTATCCCCATGGTGATGG + Exonic
1185092553 22:48784185-48784207 ACGGGCCACCCTCATGGTCACGG - Intronic
950445602 3:13035736-13035758 GCTGCCCAAGCCCATGGTGAAGG - Intronic
950484855 3:13267052-13267074 ACTCCTCATCCCCAGGGTGATGG + Intergenic
950590977 3:13935620-13935642 ACTGGCCAACCCCTATGTGATGG + Intergenic
950591022 3:13935783-13935805 ACTGGCCAACCCCTATGTGATGG + Intergenic
950591066 3:13935951-13935973 ACTGGCCAACCCCTATGTGATGG + Intergenic
950712153 3:14820346-14820368 ACTGGCCAACCCCTATGTGATGG + Exonic
952647492 3:35679127-35679149 AGTGGCAATCCCGATGGGGAGGG + Intronic
953278862 3:41532330-41532352 ACTGGGTAGCCTCATGGTGAAGG - Intronic
953981270 3:47414369-47414391 ACTGGCCAGCACCATGGTCTGGG + Exonic
954602919 3:51884997-51885019 ACTGGCCACCACATTGGTGAGGG + Intergenic
959442328 3:106392495-106392517 ATTGCCCCTCCCCATGGTGGGGG - Intergenic
961766648 3:129216828-129216850 TCTGGCCCTCCCCGTGATGAGGG + Intergenic
962982972 3:140507435-140507457 AATGGGCATCCCCATGGTTTGGG + Intronic
969454511 4:7293707-7293729 ACTGGCGATCCCTATGCAGAAGG + Intronic
971212754 4:24635624-24635646 ACTTCCCCTCTCCATGGTGAAGG - Intergenic
972474100 4:39434380-39434402 AGTCGCCATCCCCATGGATAGGG - Exonic
973641943 4:52911957-52911979 AGAGGCCATCGCCAGGGTGATGG - Intronic
976074829 4:81285755-81285777 GCTGGTCATCTCCATAGTGAAGG - Intergenic
978852927 4:113359278-113359300 AATGGCCATGACCATGCTGAAGG + Exonic
979178192 4:117691800-117691822 TCTGGCCATTCCCATGGAAAGGG + Intergenic
979541529 4:121889083-121889105 ACTGGACATCCACATGCAGAAGG + Intronic
985871477 5:2560882-2560904 AATGGCCATTGCCATAGTGAGGG + Intergenic
987985178 5:25136642-25136664 ACTTGCAACCTCCATGGTGATGG - Intergenic
988218290 5:28306609-28306631 AATGCTCATCCCCAAGGTGATGG + Intergenic
998513470 5:142732810-142732832 ACTGGACCTCTTCATGGTGATGG + Intergenic
1001883649 5:175268919-175268941 AGTGGCCATCCCAATGGGTATGG - Intergenic
1002953923 6:1843242-1843264 ACTGTCCATACCCAAGGGGATGG + Intronic
1003362357 6:5440410-5440432 TCTGGCCACCCCCATGTTGATGG + Intronic
1005016236 6:21377880-21377902 GCTGGACATTCCCATGGGGACGG - Intergenic
1006597266 6:35202561-35202583 ACTGGCCAAGCAGATGGTGAAGG + Intergenic
1006949930 6:37813360-37813382 ACTCCTAATCCCCATGGTGATGG + Intergenic
1009621777 6:66086698-66086720 AGTGGCCAACCCTAAGGTGATGG - Intergenic
1010452604 6:76019567-76019589 ATTGTCCATGCCCATGGTGGAGG - Intronic
1010691866 6:78920569-78920591 ACTGGCTATCCACATGCAGAAGG + Intronic
1013010608 6:106116601-106116623 ACTGGCCACCCCCAGAGAGATGG - Intergenic
1013160520 6:107539470-107539492 TCTGGCCATCCTTCTGGTGAAGG + Intronic
1013459930 6:110365233-110365255 ACTGGCTCCCACCATGGTGACGG + Intergenic
1013507625 6:110815467-110815489 ACTGGCCCGCCCCATGGTCGCGG + Intronic
1015933836 6:138388549-138388571 ACTAGCCTTCCACATGGAGAGGG + Intergenic
1019148058 6:169987207-169987229 ACTGCCCATCCCCCAGGTGTGGG - Intergenic
1019306043 7:336176-336198 CCTGGACATCCCCATGGTGGTGG - Intergenic
1019583050 7:1778247-1778269 ACTGGTTATCCCCGTGGGGAGGG - Intergenic
1020097430 7:5376789-5376811 ACTGGCCATGCCCAGCGAGATGG - Intronic
1022900580 7:34805887-34805909 ACTTGCCATCTTCTTGGTGAAGG - Intronic
1024157660 7:46640889-46640911 AATGGCCATCGCCAAGGTGATGG + Intergenic
1027487456 7:78779818-78779840 CCTTTCAATCCCCATGGTGATGG + Intronic
1029517167 7:101032084-101032106 ACTGGCCACCTTCATGGTGCTGG - Exonic
1032715416 7:134505105-134505127 AGTTGTCATCACCATGGTGATGG + Intergenic
1033597788 7:142868967-142868989 ACTGGCCCTCCCGCTGCTGAGGG - Exonic
1034526265 7:151664877-151664899 AGTGGCCATCGTCATGGTTAAGG + Intronic
1036225526 8:6954516-6954538 CATGGCCATTCCCATGGGGATGG + Intergenic
1036655071 8:10672593-10672615 ACTGGCCACCCCCAGGGTTCCGG + Intronic
1039387959 8:37153091-37153113 ATTGGCCATCCCTCTGGGGAAGG + Intergenic
1048256417 8:132908348-132908370 CCTGGCCTTCCCCACAGTGAGGG + Intronic
1049377337 8:142295494-142295516 CCTGGCCCTCTCCATGGTGCTGG - Intronic
1050119949 9:2297920-2297942 AATGGCCATCCCTATGTTGCAGG - Intergenic
1050251050 9:3745313-3745335 AATAGCCATCCCCAAGTTGATGG - Intergenic
1050451960 9:5791341-5791363 ACTGACCTTCCCCAAGGAGAGGG - Intronic
1056834330 9:89942445-89942467 CCTGCCCACCCCCATGGGGAGGG - Intergenic
1057444291 9:95103161-95103183 GCTGGCCATGCCCATGCTGATGG + Intronic
1060377021 9:123124838-123124860 AAGGGCCATCCCCATGATAAAGG - Exonic
1060919671 9:127411131-127411153 ACTGCCAATGCCAATGGTGAAGG - Intergenic
1061092943 9:128436952-128436974 AGTGGCCATGCCCAAGGTGGTGG - Exonic
1061904002 9:133687193-133687215 ACTGGCCATCGCTGTGGTCATGG - Intronic
1061957843 9:133972897-133972919 ACTGGCTACTCCCATGATGAGGG + Intronic
1062056811 9:134473044-134473066 ACTCGCCAGCCCCCTGGAGATGG - Intergenic
1203621780 Un_KI270749v1:134171-134193 ACTGGCCCTGCCAATGGTCATGG + Intergenic
1186066830 X:5775409-5775431 AATGGCCGCCCCCATGGTGATGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1196012100 X:110899598-110899620 ACTGGCTAGCCCCATGTAGAAGG - Intergenic
1200479855 Y:3687216-3687238 ACTGGCTAGCCACATGGAGAAGG + Intergenic