ID: 1173433799

View in Genome Browser
Species Human (GRCh38)
Location 20:43014888-43014910
Sequence GCATTTCCACACAAAGTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173433796_1173433799 -4 Left 1173433796 20:43014869-43014891 CCTAGATAAGCATTTTAAAGCAT 0: 1
1: 0
2: 3
3: 32
4: 389
Right 1173433799 20:43014888-43014910 GCATTTCCACACAAAGTATGGGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173433799 Original CRISPR GCATTTCCACACAAAGTATG GGG Intronic
902249640 1:15145835-15145857 TCATTTCTACACAAAGGAGGAGG - Intergenic
903417676 1:23195361-23195383 GTATTTCTCTACAAAGTATGGGG + Intergenic
905220126 1:36440286-36440308 GCATTTCAACACATTTTATGGGG + Intronic
905383331 1:37580310-37580332 TCACAGCCACACAAAGTATGAGG + Intronic
907911895 1:58834279-58834301 TCATTTCCCCACAAACCATGAGG - Intergenic
909565243 1:77046375-77046397 GCTCTTCCACACAAAGAATTTGG - Intronic
909887021 1:80954603-80954625 GCATTTCCACATAAATTTTAGGG - Intergenic
911169678 1:94757602-94757624 ACATTTCCAAACAAATAATGGGG - Intergenic
915183719 1:154085624-154085646 GCATTTCCACATAAATTTTTAGG - Intronic
916524444 1:165596630-165596652 TCATTTTCACACAAAGGATTTGG - Intergenic
916551868 1:165857606-165857628 GCATTTCCAGACAAAATCGGAGG + Intronic
919286747 1:195572935-195572957 GCATTTCCACAGAAATTTTAGGG - Intergenic
920391745 1:205608240-205608262 GCATCTCCAGACATAGTAAGGGG - Exonic
921631189 1:217436295-217436317 GCATGCCTACACAAAGCATGTGG + Intronic
1063162053 10:3425634-3425656 GCATTTCCTGACAAATTGTGAGG - Intergenic
1068361573 10:55980267-55980289 GCATTTCTATAAAAAGTATCAGG - Intergenic
1069079542 10:64073503-64073525 ACATCTCCACACAAAGTCTACGG - Intergenic
1069430333 10:68329385-68329407 CCATAACCACACAAAATATGCGG + Intronic
1072596708 10:96879442-96879464 CCATCTCCACACAGAGTTTGTGG + Intronic
1072835620 10:98708674-98708696 GCATTTCTACACTTAGTTTGAGG + Intronic
1073080929 10:100860242-100860264 GAATTTCAACACAAATTTTGGGG + Intergenic
1073705614 10:105980488-105980510 GAATTTCCACACAGATTATATGG + Intergenic
1074191596 10:111142746-111142768 GCATTTCCATAGAATGCATGAGG - Intergenic
1075609832 10:123843630-123843652 GCATTTCAACTCAAATTCTGGGG + Intronic
1078976057 11:16478303-16478325 TCACTTCCACATAAAGAATGGGG + Intronic
1082903050 11:58277000-58277022 GCACATTAACACAAAGTATGGGG + Intergenic
1086329508 11:85739534-85739556 GCATTTTCAGACAAAATTTGAGG - Intronic
1086616102 11:88822097-88822119 GCAGTTGCTCACAAAATATGTGG - Intronic
1086843553 11:91719412-91719434 CCATTTGCTCACCAAGTATGTGG - Intergenic
1090559880 11:127920483-127920505 GCATATCCACACAGTCTATGTGG - Intergenic
1091140124 11:133227680-133227702 GCATTTCCAGACAAAGAAACAGG - Intronic
1092616466 12:10220155-10220177 GCATATCCACTCAAAGCCTGAGG - Intronic
1093705272 12:22268172-22268194 GCATTTCTCCAGAAAGTCTGGGG - Intronic
1094267267 12:28573324-28573346 ACATCTTCACACAAAGTAAGAGG + Intronic
1094629296 12:32157509-32157531 GTATTTACACATAGAGTATGTGG - Intronic
1097667037 12:62491120-62491142 GCAATTCAACTCAATGTATGTGG - Intronic
1098878335 12:75890568-75890590 GGATTTCCACAAAACGTAAGCGG - Intergenic
1099142974 12:79002806-79002828 TCATTTCCAAACAAAGTAGGGGG - Intronic
1099638676 12:85253480-85253502 ACCTTTCAACACAAAGAATGTGG + Intronic
1099727646 12:86453769-86453791 ACATTTCCCCAGAAATTATGGGG + Intronic
1102982129 12:117250280-117250302 GCCTTTCCAAATAAAGTATGTGG + Intronic
1103855248 12:123963733-123963755 GTATTTCCACAGAAATTAAGTGG + Intronic
1103913520 12:124364456-124364478 GCCCCTCCACACAAAGTCTGTGG - Intronic
1104752376 12:131247901-131247923 GCATTTCCACACACGGTGGGGGG - Intergenic
1104779559 12:131411327-131411349 GCATTTCCACACACGGTGGGGGG + Intergenic
1107293377 13:38882734-38882756 TCATTCCCATACAAATTATGAGG - Exonic
1107350323 13:39507458-39507480 GCATTTCTCCCCAAAGTATGTGG + Intronic
1107730902 13:43347779-43347801 GCATGTTCACAGAAAGTATTTGG - Intronic
1111351998 13:87043422-87043444 GCATTTCCAACCAAAGTATCTGG + Intergenic
1112858436 13:103800215-103800237 GTATTTTTCCACAAAGTATGGGG - Intergenic
1113073081 13:106440464-106440486 TCATTTCCACTGAAAGTTTGTGG + Intergenic
1114956666 14:27829077-27829099 TCATTTCCACACAAAGAAAATGG - Intergenic
1115701376 14:35956457-35956479 GCATATCTACACAATGTATCTGG + Intergenic
1117433359 14:55692947-55692969 ACATTTCCATAAAAAGTATGTGG + Intronic
1127717211 15:61660727-61660749 GCCTTTCCACGCAAGGTCTGTGG + Intergenic
1129228530 15:74183739-74183761 GCATTCCCAGACAAACTCTGAGG + Intronic
1132119440 15:99164083-99164105 GGATTTCCAGACCAAGTAGGTGG - Intronic
1140628712 16:76826164-76826186 GCATTTACACACAAAATACATGG - Intergenic
1143314327 17:6020590-6020612 ACATTTCAATAGAAAGTATGTGG + Intronic
1145390308 17:22450667-22450689 TCATTTTCACCCAAAGTCTGTGG + Intergenic
1145876897 17:28325738-28325760 GCATTCTCCCACAAACTATGGGG - Intronic
1147968077 17:44204769-44204791 GCATTTTCACCCAAAGTACATGG - Intergenic
1148706622 17:49639387-49639409 GCAATTCCACTCCAAGTATATGG + Intronic
1148960229 17:51386237-51386259 CCCTTTCCTCACAGAGTATGGGG - Intergenic
1164737849 19:30554939-30554961 GCATTACCAGACAATGGATGGGG - Intronic
926984478 2:18607315-18607337 CCATTTTCACTCCAAGTATGAGG - Intergenic
931378667 2:61731815-61731837 GCAATGGCACACAAAGGATGCGG + Intergenic
931676458 2:64701443-64701465 AGATTTCCACACAAAATATTGGG + Intronic
934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
937543523 2:122988585-122988607 GCACTTACACACAAAGCATGGGG + Intergenic
939018094 2:136925088-136925110 GCTTTTCCACACACACAATGAGG + Intronic
939702776 2:145414451-145414473 GCATTTTAACACAAACTTTGAGG - Intergenic
939750014 2:146032230-146032252 GCATTTCAACAAATTGTATGAGG + Intergenic
940900550 2:159122819-159122841 GCATTTTCACCAACAGTATGAGG + Intronic
942022572 2:171881450-171881472 ACATTTACACAGAAAATATGGGG - Intronic
943174519 2:184453143-184453165 TCATTTACATACAATGTATGAGG - Intergenic
943398299 2:187370763-187370785 GCATTTCTACATAAAGTATACGG - Intronic
944521156 2:200568557-200568579 GCATTTATACACAAAATTTGGGG + Intronic
947758139 2:232583729-232583751 GCATTCCAAAACAAAATATGTGG + Intergenic
948219593 2:236259226-236259248 GCATTTCCACAGACACTATTGGG - Intronic
1170018004 20:11803874-11803896 GCATTTGAGCACAAAGTAGGAGG - Intergenic
1170981430 20:21217833-21217855 GCATTTCCAAACCAGCTATGAGG + Intronic
1173433799 20:43014888-43014910 GCATTTCCACACAAAGTATGGGG + Intronic
1175918198 20:62437389-62437411 GCATTTCCACCCCAAGACTGGGG + Intergenic
1179176066 21:39009200-39009222 CCACTTCCACACAAGGCATGGGG + Intergenic
1182794036 22:32977364-32977386 GGATTTCCACACATGGGATGAGG + Intronic
1183018605 22:35009530-35009552 GAGGTCCCACACAAAGTATGTGG - Intergenic
949245311 3:1919544-1919566 GCATTTCCAACTGAAGTATGTGG - Intergenic
951226861 3:20130554-20130576 GCATTTCCAAACAAGGTGTTTGG - Intronic
951757145 3:26103340-26103362 GCAATTCCACCCAAAGTACCTGG - Intergenic
954223114 3:49166407-49166429 CCATTTCCCCACAAAGTCTGGGG + Intergenic
954279251 3:49564311-49564333 GCATCTTCACACGAAGTCTGGGG + Intronic
955297160 3:57746440-57746462 GCATTGCCACACTAAGCATTAGG - Intergenic
955569088 3:60284364-60284386 ACAGTTCCAAACATAGTATGTGG + Intronic
957937847 3:86967388-86967410 GCTTTTCTAAACAAAGTATCAGG - Intronic
960422476 3:117464078-117464100 GCATTTTTAATCAAAGTATGAGG - Intergenic
960428462 3:117538452-117538474 GCATTGCCACAGAGAATATGAGG - Intergenic
961132732 3:124483898-124483920 TCATTTCCACAGAAAGCCTGGGG + Intronic
963447065 3:145425911-145425933 TTATTTTCACACAAAGGATGAGG - Intergenic
970682918 4:18532219-18532241 GCATTCCCACTGAAAGTAAGTGG + Intergenic
974067693 4:57095060-57095082 GCACTTCAGCACAAAGTTTGGGG - Intronic
979010409 4:115360238-115360260 GCATTTAGACATAAAGAATGGGG + Intergenic
979186474 4:117801498-117801520 GCACTTCCACACCATGTTTGAGG - Intergenic
979729018 4:123999249-123999271 GCCTTTCCACAGAAAGTAACAGG + Intergenic
981223204 4:142261043-142261065 GCACTTGCTCAAAAAGTATGAGG + Intronic
984061074 4:174989662-174989684 GCCTTTCCACACAGATGATGAGG - Intergenic
984841844 4:184075943-184075965 GCCTTTCCCTACAAAGTAAGGGG + Intergenic
986068284 5:4257080-4257102 GCAGTTCCACACAGCTTATGAGG + Intergenic
989140083 5:38193316-38193338 GCATTGCCACTCAGAGGATGTGG + Intergenic
989205638 5:38806706-38806728 GCATTTCCAAACAAACCATCAGG - Intergenic
992120865 5:73590684-73590706 GCATTACCACACAAAGACTTTGG - Intergenic
993352366 5:86866226-86866248 GCATTGGCACACAACGTATTTGG - Intergenic
993397736 5:87412142-87412164 ACATTTCCACTGAAAGGATGAGG - Intronic
993724184 5:91349512-91349534 CCATGTCCTCACATAGTATGAGG - Intergenic
994662121 5:102666697-102666719 GAAGTTCCACACAAAGAATGAGG + Intergenic
996837710 5:127812278-127812300 GCATTCTCTCACAAAGAATGTGG - Intergenic
999572341 5:152933954-152933976 GCATTTCTAGAGAAGGTATGTGG + Intergenic
1000097175 5:157981813-157981835 GACTTGCCACACAAACTATGAGG - Intergenic
1005097729 6:22136340-22136362 TCATGTCCACTCAAAGTAAGTGG - Intergenic
1008319753 6:50095399-50095421 AAATTTCAATACAAAGTATGAGG - Intergenic
1011202043 6:84847262-84847284 GCCTTTCCACATAAAATAAGTGG + Intergenic
1015731345 6:136351475-136351497 TACTTTCCACACAAAGTATTGGG - Intronic
1016452524 6:144197918-144197940 CCAAGTCCACACAGAGTATGTGG - Intergenic
1017004358 6:150019564-150019586 GCCTTCCCACAGAAAGTAGGTGG - Intronic
1022269487 7:28792496-28792518 GCATTTCCAACCAAAAAATGAGG - Intronic
1022371029 7:29771570-29771592 GCATTTCCACTCACAGTTTGAGG - Intergenic
1022640507 7:32178069-32178091 TCATTTCCACCCAGATTATGTGG - Intronic
1027741452 7:82011587-82011609 GTATTTCCATAAAAAGTATGAGG + Intronic
1031031510 7:116740594-116740616 GCATTGCCACACAATGTTAGAGG - Intronic
1031842556 7:126761949-126761971 GCATTTACAAACACAGTATAAGG - Intronic
1032691275 7:134289588-134289610 GGATTTCCTAACAAATTATGTGG - Exonic
1034410887 7:150941579-150941601 GTCTTTCCACACCAAGGATGAGG + Intergenic
1036383059 8:8251717-8251739 ACATTCCCACACAAAGAATAAGG - Intergenic
1037155910 8:15697995-15698017 GTATTTCAACACACAGTTTGGGG - Intronic
1037501617 8:19491028-19491050 GAATTTCCAAAGAAAGTATCTGG + Intronic
1039933183 8:42013601-42013623 GCATTTAAACACAATATATGGGG + Intronic
1041617904 8:59929687-59929709 GCACTTCCAAACAGAGCATGTGG + Intergenic
1043443451 8:80297363-80297385 GCATTTACACAGAAGGTATCAGG + Intergenic
1050287156 9:4115339-4115361 GCATTTCCAAAAGAAGAATGTGG + Intronic
1051565146 9:18489026-18489048 GGAATTCCAAACAAAGTATCTGG + Intronic
1053427420 9:38019623-38019645 GCATTTCCACTGAAAGCATGTGG - Intronic
1053926972 9:43071188-43071210 TCATTTCCACACAAAGAAGATGG - Intergenic
1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG + Intergenic
1054388314 9:64585098-64585120 TCATTTCCACACAAAGAAGATGG - Intergenic
1054769063 9:69067553-69067575 TCTTTTCCACAGAGAGTATGGGG - Intronic
1055696734 9:78892970-78892992 GCATTTCCTCAGAAATTCTGAGG - Intergenic
1056455161 9:86752672-86752694 GCAATTCCATACCAAGTATTTGG + Intergenic
1057622478 9:96648581-96648603 GCATTGCCAAACAAAATATTAGG - Intronic
1058154782 9:101502962-101502984 GCATTTGTGCACAAAGCATGTGG + Intronic
1059400959 9:114070619-114070641 GCACTTGCACACAGAGCATGGGG + Intronic
1186769193 X:12800883-12800905 CCATTTACAGATAAAGTATGTGG - Intronic
1187974546 X:24692224-24692246 GTCTTTTCCCACAAAGTATGTGG + Intergenic
1190587140 X:51957104-51957126 GCATTTCCACATAAATTTTAAGG + Intergenic
1194607426 X:95998208-95998230 GCATTTCCATGCAAAGCAAGGGG - Intergenic
1197377662 X:125701621-125701643 GCATTTGCACAGAGACTATGGGG + Intergenic
1198997294 X:142587945-142587967 GAAATTCCACAGAAAATATGGGG - Intergenic
1201899200 Y:19030145-19030167 GCATTTTCACAAATAGCATGGGG + Intergenic