ID: 1173437184

View in Genome Browser
Species Human (GRCh38)
Location 20:43043918-43043940
Sequence TGGGATAAGCAGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173437184_1173437192 25 Left 1173437184 20:43043918-43043940 CCTTCCTCTGTCTGCTTATCCCA 0: 1
1: 0
2: 2
3: 32
4: 452
Right 1173437192 20:43043966-43043988 AGTCTGGTCTCTTGTGATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 117
1173437184_1173437189 9 Left 1173437184 20:43043918-43043940 CCTTCCTCTGTCTGCTTATCCCA 0: 1
1: 0
2: 2
3: 32
4: 452
Right 1173437189 20:43043950-43043972 ACAGCTGATATGCCCAAGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173437184 Original CRISPR TGGGATAAGCAGACAGAGGA AGG (reversed) Intronic
900931367 1:5739892-5739914 GGGGATAAGGACAGAGAGGAGGG + Intergenic
903295821 1:22342574-22342596 AGAGATAAGGAGACAGAGAAAGG + Intergenic
903607959 1:24588848-24588870 AGGGTTCAGCAGACAGACGAGGG - Intronic
904025335 1:27499295-27499317 TGGGACAGGCTTACAGAGGAAGG + Intergenic
904392964 1:30197825-30197847 TGGGAAAGGCAGACAGAAGGAGG + Intergenic
904752965 1:32752537-32752559 TGTGATGAGGAGACAGAGGTGGG + Intronic
905187059 1:36204281-36204303 TGGGATAGGGACACAGCGGAGGG - Intergenic
905574686 1:39034422-39034444 CGGGATAAGCTGATAAAGGAAGG + Exonic
906480634 1:46197199-46197221 AGAGCTAGGCAGACAGAGGAAGG - Intronic
907111148 1:51927689-51927711 TGGGATCAGGAGACTGAGGCAGG + Intronic
907198915 1:52709368-52709390 CGGGATAAGCTGATAAAGGAAGG + Intergenic
908039807 1:60099199-60099221 TGGAAAAATCAGACAGAGAAAGG - Intergenic
908122717 1:61001162-61001184 TAGAATAAGGAGACAAAGGAGGG - Intronic
908171069 1:61505244-61505266 TGGGGTAAGCATAGAGAAGAGGG - Intergenic
909506509 1:76396548-76396570 TGAGCTAAGCAGACAGAGGTAGG - Intronic
910349592 1:86280579-86280601 TATGATCAGCTGACAGAGGAAGG + Intergenic
911291856 1:96066010-96066032 TGGAAAAAGCAGGCAGAAGAAGG + Intergenic
911336281 1:96584466-96584488 TGGAATAAGCTGATAAAGGAAGG - Intergenic
912101370 1:106210295-106210317 GGTGATAAGCACACAGAGGCAGG - Intergenic
912595354 1:110870661-110870683 TGGGACAGGCAGAGAGAGTAAGG - Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913462038 1:119097927-119097949 TGGGATAGGCAGTCTGAGAAGGG - Intronic
914504549 1:148277566-148277588 TGGGATAAACAGAGAAAAGAAGG - Intergenic
914509747 1:148320711-148320733 TGGGATAAACAGAGAAAAGAAGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915236015 1:154483178-154483200 TGAGATAAGCATAAATAGGAAGG - Exonic
915901000 1:159846757-159846779 TGGGATAAGAGGACAGGGTAAGG + Intronic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916163194 1:161940322-161940344 GGCAATAAGGAGACAGAGGAAGG - Intronic
916688802 1:167171631-167171653 TGGCACAAGCAGGCAGAAGAAGG - Intergenic
916876091 1:168971127-168971149 TGGGGGAAGGAGACAGAGGCAGG + Intergenic
917155935 1:171999032-171999054 TGGGCTGAGCAGCCAGTGGAGGG + Intronic
917645308 1:177023722-177023744 AGGGATCAGCAGACAGAGGCTGG + Intronic
918963567 1:191310259-191310281 TGGGATTACCAGGCAGAGAAAGG + Intergenic
920010318 1:202862162-202862184 TGGCCAAAGCAGACTGAGGAGGG + Intergenic
920199760 1:204252338-204252360 TGGGATGAGGAGGAAGAGGAAGG + Intronic
920859564 1:209694369-209694391 TGGGAAAGGCAGACAGTGAATGG + Intronic
921161434 1:212475020-212475042 TGTGATCAGCACAAAGAGGAAGG + Intergenic
921692564 1:218166434-218166456 TGAAATCAGCAGAGAGAGGAGGG + Intergenic
921783319 1:219195556-219195578 TGGGAAAGGAAGAGAGAGGATGG - Intronic
922041633 1:221903524-221903546 TGAGGTACGCAGACAGAGGAGGG + Intergenic
923338692 1:232990616-232990638 TGGGCTCAGCAGACAAAGGTTGG - Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063296240 10:4809672-4809694 CGGGATGAACAGACAGATGAAGG + Intronic
1063556140 10:7081437-7081459 TGGGGAATGCAGGCAGAGGAGGG - Intergenic
1063982362 10:11464412-11464434 TGCGATAGGCAGACAGTGCAGGG + Intronic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064581116 10:16794002-16794024 TAGAATAAGAAGGCAGAGGAAGG + Intronic
1064807989 10:19159425-19159447 GGCAATAAGCAGACTGAGGAAGG + Intronic
1067013120 10:42732913-42732935 TGGGCTAAGGAGGAAGAGGAGGG + Intergenic
1067467375 10:46511068-46511090 TGCGATAAGCTGACTCAGGATGG - Intergenic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1067619811 10:47873537-47873559 TGCGATAAGCTGACTCAGGATGG + Intergenic
1068302072 10:55156813-55156835 TGGGCTAAACAGAGAGAGGTTGG + Intronic
1068582243 10:58754822-58754844 TGGTTTGAGAAGACAGAGGAAGG + Intronic
1068735529 10:60409748-60409770 TGGGATCAGAAGCTAGAGGAGGG - Intronic
1068916571 10:62438825-62438847 TGTGAGAAGCATACTGAGGAAGG - Intronic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069038630 10:63671618-63671640 TGGGGGATGGAGACAGAGGAGGG - Intergenic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070402667 10:76067095-76067117 TGGGACAAGGAGACAGCTGATGG + Intronic
1070442921 10:76464257-76464279 TGGGCTAAGCTGGCAGAGAAGGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070988356 10:80708228-80708250 TGGGATAAGCGGAATGGGGAAGG + Intergenic
1071794098 10:88987043-88987065 TGGGAAAGGAAGAGAGAGGACGG - Intronic
1072726845 10:97819547-97819569 TGGGCCAGGCAGACAGAAGAGGG - Intergenic
1072910457 10:99496496-99496518 TGGAATCAGTAGACTGAGGAAGG - Intergenic
1073926433 10:108521593-108521615 GGAGGAAAGCAGACAGAGGAGGG - Intergenic
1074035106 10:109730967-109730989 TGAGATGAGCAGATAGAGGCAGG + Intergenic
1074889817 10:117726148-117726170 TGGGAAAAGGAGAGAAAGGAAGG - Intergenic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075551219 10:123394149-123394171 TGGGCTATGCAGACAGAGAAAGG + Intergenic
1076211942 10:128655843-128655865 TGGGGACAACAGACAGAGGAGGG + Intergenic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076718487 10:132381171-132381193 TGGAAAAAGCAGGCAGAAGAAGG + Intergenic
1077155325 11:1088518-1088540 TGGGGCAAGTAGGCAGAGGAGGG + Intergenic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078161532 11:8843818-8843840 TTGGCTTAGCAAACAGAGGAGGG - Intronic
1078340755 11:10496648-10496670 TGGGAGAGGAGGACAGAGGAGGG + Intronic
1078725792 11:13929787-13929809 TGGGAAAAGCATTCAGGGGAAGG + Intergenic
1078734367 11:14006606-14006628 TGGGATGAGGAGACAGCAGAGGG - Intronic
1079094785 11:17503177-17503199 TGTGGGCAGCAGACAGAGGAGGG + Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1080264305 11:30385571-30385593 TGCAATAAGAAGACAGTGGAAGG - Intronic
1080286579 11:30621024-30621046 TAGGATGAGAAGACAGATGAAGG - Intergenic
1080352500 11:31401494-31401516 TGGGAGAGGTAGGCAGAGGAAGG - Intronic
1081564526 11:44249498-44249520 TGGGAGTGGCTGACAGAGGAGGG + Intergenic
1081588927 11:44407488-44407510 TGAAATAAGAAGGCAGAGGATGG - Intergenic
1081868595 11:46372881-46372903 TGGGGTAAGCACCCATAGGAGGG + Exonic
1083737085 11:64687553-64687575 TACCATAAGTAGACAGAGGAAGG - Intronic
1084026666 11:66454787-66454809 AGGGAAGAGCAGACAGAGGAGGG - Intronic
1084936198 11:72588034-72588056 GGGGAGAAGTAGACAGATGAGGG - Intronic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1089875430 11:121716904-121716926 TGGGATAAGCATATAGAGACAGG + Intergenic
1090689599 11:129165084-129165106 TGGGATGAGAAGGCAGAGGTTGG + Intronic
1091238938 11:134039614-134039636 GGGGAAAAGGAGACAGAGAAAGG + Intergenic
1091306267 11:134538193-134538215 TGGGAGAGGCAGGCAGCGGATGG + Intergenic
1093013206 12:14129822-14129844 TGGGATAAGCAGCCGGAGCAGGG - Intergenic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095528611 12:43158024-43158046 TGAGAAAAGCAGCAAGAGGATGG + Intergenic
1095734430 12:45541181-45541203 GGGAATAAGAAGAGAGAGGAGGG - Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1097687214 12:62702429-62702451 TGGGTTAAGCAATCAGAGTAGGG - Intronic
1098094782 12:66943338-66943360 TGGGATGAGGAGAGAGAGCACGG + Intergenic
1098860050 12:75698786-75698808 AGGAATAAGCAGACAGAAGCTGG + Intergenic
1100978428 12:100145496-100145518 TGCTATAAGAACACAGAGGAAGG + Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101652862 12:106693610-106693632 TGGGATCAGGGGACAGTGGAGGG + Intronic
1102909296 12:116700200-116700222 GGGGATAACCAGACAGAGATGGG + Intergenic
1103891718 12:124243944-124243966 TGGGGTTACTAGACAGAGGAGGG - Intronic
1104038416 12:125114327-125114349 TGGGAGAAGCAGACTTTGGAGGG - Intronic
1104684920 12:130778549-130778571 GGAGGAAAGCAGACAGAGGAGGG - Intergenic
1104704633 12:130933979-130934001 TGGGATAAGCAGCTAGTGGGGGG - Intergenic
1107390258 13:39956164-39956186 TGGGGTCAGAAGGCAGAGGATGG + Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108709624 13:53019924-53019946 TGAGATAAGAAGACTGAGAATGG - Intergenic
1108734041 13:53263877-53263899 TGAGACAAGCAGGCAGAAGATGG - Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1108941621 13:55963114-55963136 TAGGAAAAGCAGACAAAAGAAGG - Intergenic
1109333243 13:60958360-60958382 TAGAAAAAGCAGACAGAAGAAGG + Intergenic
1109653958 13:65365959-65365981 GGAGATAAGCAGACAGATGGTGG + Intergenic
1112207302 13:97337429-97337451 TGGGCAAAGGAGACGGAGGAAGG - Intronic
1113545785 13:111148468-111148490 AGGGATATGCAGGCACAGGATGG + Intronic
1114419461 14:22568997-22569019 TGAGACAAGAAGTCAGAGGAGGG - Intronic
1114583499 14:23787461-23787483 TGGGCTAAGAAGCCAGAGGTTGG + Intergenic
1115747803 14:36455661-36455683 TGAGAAAAGCAAGCAGAGGAAGG - Intergenic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1116481838 14:45400461-45400483 AGGAAAAAGCAGGCAGAGGATGG + Intergenic
1116704236 14:48276277-48276299 TGGGATAACTAAAGAGAGGAGGG - Intergenic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117174858 14:53135386-53135408 TGGGATAGGCAGGCAGCGGGTGG - Intronic
1117734618 14:58756069-58756091 TGGGTGAAGCAAACAGAGAAAGG - Intergenic
1118231036 14:63950116-63950138 TGGAAGAAGCACAGAGAGGAAGG - Intronic
1118696087 14:68386638-68386660 TGGGATTAGAGGACAGAGGAAGG - Intronic
1119073171 14:71608079-71608101 TGGGCTCACCATACAGAGGAGGG - Intronic
1119793604 14:77376591-77376613 TGTGATTAGCAGACGGAGGTGGG + Intronic
1120253366 14:82088202-82088224 TGTGAGAATCTGACAGAGGAAGG - Intergenic
1121732861 14:96198279-96198301 AGGGATAGACGGACAGAGGAAGG + Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122299499 14:100723823-100723845 AGGGATGCGCAGATAGAGGAGGG + Intergenic
1126413339 15:48394325-48394347 TGGGTTAAGGAGACCCAGGAGGG - Intergenic
1126963711 15:54027706-54027728 TGTCTTAAGCAAACAGAGGATGG - Intronic
1126966703 15:54062345-54062367 TAGGAGAATCACACAGAGGATGG - Intronic
1127504312 15:59583072-59583094 TGGGGTACCTAGACAGAGGATGG - Intergenic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1128518524 15:68359973-68359995 AGTGCTGAGCAGACAGAGGAAGG + Intronic
1128815093 15:70602409-70602431 TGGGAGAAGGGGACAGAGGGTGG - Intergenic
1129343194 15:74899536-74899558 TGGGAACAGCAGAAAGGGGAGGG + Exonic
1132649111 16:1012575-1012597 TGGGAAAGGCAGGCAGAGGCTGG - Intergenic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133839199 16:9393626-9393648 TGGGATGAGAACACAGAAGATGG + Intergenic
1134107949 16:11497475-11497497 TGGGCAAAGCAGTCAGAGGCGGG - Intronic
1135326248 16:21527514-21527536 TGGAAGCAGCAGCCAGAGGAAGG - Intergenic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135697564 16:24603397-24603419 TGAGATGAGGAGACAGAGCAGGG - Intergenic
1136552400 16:30988736-30988758 TGGGATGAGAGGACAGAGGAAGG - Exonic
1137847299 16:51703260-51703282 TGGGACAAGGGGTCAGAGGATGG + Intergenic
1138211540 16:55167235-55167257 TGGGAGAAGTAGACAGATCATGG + Intergenic
1138376068 16:56564931-56564953 TGGGAAGAGCAGGCGGAGGAGGG - Intergenic
1139538512 16:67595563-67595585 CGGTATAAGGATACAGAGGATGG + Intronic
1139572919 16:67824564-67824586 TGGGCTAAGCAGAGACAGGTGGG - Exonic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140430537 16:74899071-74899093 TGGGAGAGGAAGACAGAAGAGGG + Intronic
1141754421 16:85982028-85982050 TGGGATAAGCAGCCAAGGGGTGG - Intergenic
1141806353 16:86344289-86344311 AGGGAAAAGAAGACAGAGGGGGG + Intergenic
1142039295 16:87882241-87882263 TGGAAGCAGCAGCCAGAGGAAGG - Exonic
1142103211 16:88286501-88286523 TCAGATCAGCAGCCAGAGGATGG - Intergenic
1142728126 17:1831156-1831178 TGGAATAAGCAGACAGATGACGG - Intronic
1142943199 17:3400684-3400706 TGGGACAAACAGAAAGAAGAAGG + Intergenic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144502584 17:15802070-15802092 TGGGTCAAGCAGAGAGAAGATGG - Intergenic
1144670528 17:17130311-17130333 AGGGACAAACAGACAAAGGAAGG - Intronic
1145164761 17:20604724-20604746 TGGGTCAAGCAGAGAGAAGATGG - Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1145913260 17:28554832-28554854 TGAGGTAAGCAGGCAGGGGATGG - Exonic
1146118713 17:30169148-30169170 TAGAATAAGCAGACTGAGAAAGG - Intronic
1146266725 17:31457840-31457862 GGGGAAAAGGAGAGAGAGGAAGG - Intronic
1146502113 17:33373040-33373062 TAGGATAAGCAGAAAGGGAATGG + Intronic
1146543174 17:33715446-33715468 TGAGACAAGCACAAAGAGGATGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147262182 17:39214995-39215017 CGGGATGAGCTGACCGAGGATGG - Exonic
1147386995 17:40088823-40088845 TGGGACTGGGAGACAGAGGAGGG - Intronic
1148330957 17:46813717-46813739 GGGGATAAGGAGCCAGGGGATGG - Intronic
1148386770 17:47239801-47239823 AGGGTGAGGCAGACAGAGGATGG + Intergenic
1148759941 17:49994422-49994444 CGGGATGAGCTGAGAGAGGAAGG - Intronic
1149116623 17:53105049-53105071 TGGAATAAGAAGGCAGAAGAGGG + Intergenic
1149631945 17:58133291-58133313 TGTGTTAGGCAGACAAAGGAGGG - Intergenic
1149932706 17:60771692-60771714 TGGGATAGGGGGACAGGGGAGGG - Intronic
1150221843 17:63500053-63500075 GGGGTTAGGCAGACAGAGGAAGG - Intronic
1151531201 17:74706065-74706087 TGGGAACAACAGGCAGAGGAGGG + Intronic
1152879260 17:82806155-82806177 TGGGTTCAGGAGCCAGAGGACGG - Intronic
1153698299 18:7666264-7666286 TGGGAAGAGAAGACAAAGGAAGG - Intronic
1154286050 18:13057651-13057673 TGGATTAAGCACACTGAGGAGGG - Exonic
1155633429 18:27922431-27922453 TAGCATAAGCAGACAGGGGTAGG - Intergenic
1155860950 18:30898718-30898740 TGGGATGGGCAGAGAGGGGAGGG + Intergenic
1155958592 18:31974950-31974972 TGGCATCAGGAGACAGAGGCTGG + Intergenic
1156127225 18:33920964-33920986 TGGGACAGGAAGACAGAGCATGG + Intronic
1156470804 18:37376274-37376296 GGGGATAGGAAGCCAGAGGAAGG - Intronic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157762577 18:50275333-50275355 TGGGACAGGCAGACAGAGGGTGG + Intronic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1159972799 18:74674669-74674691 TGGTGTAAGCAGACAAGGGATGG - Intronic
1160077660 18:75693513-75693535 GGGGAGGAGCAGACAGAGGGAGG + Intergenic
1160559808 18:79749251-79749273 TGGGGCAAGCAGGGAGAGGAGGG - Intronic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1161362435 19:3858294-3858316 TGGGATCTGCAGATAGAGGCAGG + Intronic
1161572595 19:5038656-5038678 TGGGGTGAGCAGACAGACTATGG - Intronic
1161736939 19:5997216-5997238 GGGGACAAGCGGACAGAGGCTGG + Intronic
1164773769 19:30834488-30834510 TGTCATATGAAGACAGAGGATGG + Intergenic
1166685365 19:44793358-44793380 TGGGGAAGACAGACAGAGGAAGG - Intronic
1166819319 19:45567506-45567528 TCAGATAAGGAGACAGAGCAGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166902114 19:46072624-46072646 TGTGATCAGGAGACAGAGGCAGG + Intronic
925331273 2:3060619-3060641 TGCAGTAAGCAGACAGAGGGAGG + Intergenic
925644982 2:6026657-6026679 TGGCAAACACAGACAGAGGAGGG - Intergenic
925694652 2:6563252-6563274 TGGGAAAAGCAGAGAGGGAAAGG - Intergenic
925987927 2:9231080-9231102 TGGCATAAGAAGAAAAAGGAAGG - Intronic
926019549 2:9483192-9483214 TGGGCAAAGCAGGTAGAGGAGGG + Intronic
927188297 2:20498043-20498065 TGGGACAAGGGGACAGAGAAGGG - Intergenic
928129004 2:28635755-28635777 TCAGATAAGAAGACAGAAGAAGG - Intronic
928413160 2:31070012-31070034 GGGGGTAAGCGGACACAGGAAGG - Intronic
929500988 2:42491956-42491978 AGGAATAAGCAGACTAAGGATGG - Intronic
930697435 2:54426316-54426338 TGGGATAAGCCTAGAAAGGAAGG - Intergenic
930875630 2:56212309-56212331 TGGGATATGTAGACAAAAGATGG - Intronic
931006702 2:57857961-57857983 TGGGACAACTAGACAGGGGAGGG - Intergenic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
931991999 2:67799753-67799775 TGGTAAAAGCAGACAGAGACAGG + Intergenic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
934040773 2:88126031-88126053 TGGGAGAAGCAGAGAGACAAAGG - Intronic
935140441 2:100348659-100348681 TGGGCTTAGGAGACAGAGGTTGG - Intergenic
935183982 2:100715215-100715237 TGTGATCAGTTGACAGAGGAAGG + Intergenic
936480367 2:112879914-112879936 TGCTAGAGGCAGACAGAGGATGG - Intergenic
937125341 2:119471767-119471789 AGGTATCAGAAGACAGAGGACGG + Intronic
938116404 2:128605656-128605678 TGGGATCAGCAGACAGCAGGTGG - Intergenic
938173159 2:129100965-129100987 AGGGATAACCAGACAGAACATGG - Intergenic
939145214 2:138405678-138405700 TGAAATAAGCAGGCACAGGAGGG - Intergenic
940207778 2:151223154-151223176 TAGGAAAAGCAGGCAGAAGAAGG + Intergenic
941012988 2:160322434-160322456 AGGGATAACAAGACAGAGGATGG + Intronic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941947763 2:171118958-171118980 TAGAAGAAGTAGACAGAGGAAGG - Intronic
942891758 2:180998444-180998466 TGGGATAAGGAGAGTGGGGAAGG + Intronic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
945106855 2:206324198-206324220 TGGGCTAATCCCACAGAGGAGGG - Intergenic
945612115 2:212016225-212016247 TGTGATAATCAGACAGAAAAAGG + Intronic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946034918 2:216734145-216734167 TGAGAAAAGGTGACAGAGGAGGG - Intergenic
947359937 2:229336328-229336350 AGGGACAGGCAGACACAGGATGG + Intergenic
948260540 2:236601220-236601242 TGGGAGAACCAGGCAGAGGCTGG - Intergenic
948789820 2:240371461-240371483 TGAGGGAACCAGACAGAGGATGG + Intergenic
1168824414 20:799932-799954 TGATATTAGCAGAAAGAGGAGGG + Intergenic
1169645587 20:7806174-7806196 TGGGAAAAGCAGAGAGAGGTTGG - Intergenic
1169669370 20:8078664-8078686 GGGGAGAGGCAGACACAGGAAGG - Intergenic
1169843735 20:9967072-9967094 AGGGATAAAAAGACAGAGGCCGG + Intergenic
1170161888 20:13321538-13321560 AGGCCTAGGCAGACAGAGGAAGG - Intergenic
1170263113 20:14434640-14434662 TGGGATGAGCCAACAGAGAAGGG - Intronic
1170937658 20:20823945-20823967 TGTGATCACCTGACAGAGGAGGG - Intergenic
1171079038 20:22159109-22159131 TCCCAAAAGCAGACAGAGGATGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1172134801 20:32679755-32679777 TGGGATAAGCTTACAGAAGGAGG - Intergenic
1173051742 20:39569347-39569369 TGGCATAAAAAGACAGAAGATGG + Intergenic
1173076509 20:39824499-39824521 TGGGAGGAGCACCCAGAGGATGG - Intergenic
1173093976 20:40006468-40006490 TTGGATATGTAGACAGATGATGG + Intergenic
1173365360 20:42380193-42380215 TGGGATAAGGAAACTGAGGCAGG - Intronic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1174138891 20:48399025-48399047 TGGGAAAGGCCCACAGAGGATGG - Intergenic
1174404648 20:50295503-50295525 TGCAATAAGCAAACAGAAGAGGG + Intergenic
1174956120 20:55100443-55100465 TAGAAAAAGCAGGCAGAGGAAGG - Intergenic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175472732 20:59243470-59243492 TGCCATAAGTAGACAGAGGGAGG + Intronic
1175764714 20:61584392-61584414 TGGGATGAGCAGAAAGGGCAGGG - Intronic
1176787179 21:13271037-13271059 TGGGAGAAAAAAACAGAGGATGG + Intergenic
1176843278 21:13857464-13857486 AGGGAGTAGCAGACAGAGGTCGG - Intergenic
1177564668 21:22804355-22804377 TGGGAAAGTGAGACAGAGGAAGG - Intergenic
1177809990 21:25915361-25915383 TGGGACAAGGAGACTGAGGCTGG + Intronic
1177940850 21:27409862-27409884 AGGATAAAGCAGACAGAGGAAGG - Intergenic
1178897987 21:36576534-36576556 TGGGAAAAGCTGAGAGAGGCAGG - Intronic
1179269746 21:39841464-39841486 TGGGAGATGCAGACAGGGCATGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179629857 21:42669622-42669644 TGGAATCAGCAGACTGAGGCTGG + Intronic
1180050561 21:45329244-45329266 TGGTAAAGGCAGGCAGAGGATGG - Intergenic
1181684961 22:24522080-24522102 TGGAGGAAGCAGACAGAGAAGGG - Intronic
1181911377 22:26240961-26240983 TGCCAGAGGCAGACAGAGGAGGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182789698 22:32940859-32940881 TAGGTTAAGGAGACAGAGGATGG - Intronic
1183321834 22:37169695-37169717 CGGGATAAGAAGGCAAAGGAAGG - Intronic
949126617 3:452731-452753 TAGGATGAGGATACAGAGGAAGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
951233663 3:20209765-20209787 TGAAATAATCACACAGAGGATGG - Intergenic
953150498 3:40320028-40320050 TGGGAAAATGAGACAGAGAAGGG - Intergenic
953582115 3:44166817-44166839 TGGGAAAACCAAACAGAGGAGGG - Intergenic
953813716 3:46135684-46135706 TGGGGTGAGCAGAGAGAGGGAGG - Intergenic
955093935 3:55778340-55778362 TGTGGTAAGAAAACAGAGGAAGG + Intronic
955765033 3:62334693-62334715 TGAAAAAAGAAGACAGAGGAAGG + Exonic
956101463 3:65772551-65772573 TGGGATCAGCAGCCATAAGAAGG + Intronic
956342835 3:68246068-68246090 TGGAAATAGCAGACAGAGGATGG - Intronic
957640781 3:82850403-82850425 AGGGATAAGAAGAAAGAAGAAGG - Intergenic
958111877 3:89158571-89158593 TGGGAAAAGCAGACATAATAAGG - Intronic
960601001 3:119458328-119458350 TGGGGAAAGCAGACAGTGAAGGG - Intronic
960768730 3:121167961-121167983 TGGGACAAGCTTCCAGAGGAAGG + Intronic
961104269 3:124227904-124227926 TGGGATTGGGAGACTGAGGATGG + Intronic
962693473 3:137924973-137924995 TGGGAAAAGAAGAGAGTGGATGG - Intergenic
963112321 3:141697898-141697920 TGGGATAAGGAGACAGTTGCGGG + Intergenic
963280279 3:143377830-143377852 TGGGAGAAACAGACAGGGGCAGG - Intronic
964565738 3:158050564-158050586 TGGTATAAGTAGAAAGAGGGTGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965599645 3:170442220-170442242 TGGGAAATGTAGACTGAGGATGG + Intronic
966120418 3:176513743-176513765 TGGGTTATACAGAGAGAGGAAGG - Intergenic
967311712 3:188112360-188112382 TGAGATAAGCAACCTGAGGAAGG - Intergenic
967851642 3:194087001-194087023 TGTGAAAAGCACCCAGAGGAAGG + Intergenic
969508761 4:7605188-7605210 TGGGATATGCAGACAATGGCTGG - Intronic
969550208 4:7860955-7860977 GGGGAGCAGCAGACAGAGGGCGG - Intronic
969660365 4:8523905-8523927 TGGGATCAGCCGTCAGAGGCTGG - Intergenic
969840015 4:9874407-9874429 TGGGGTAAGCAGACAGCTGTGGG - Intronic
970353340 4:15228124-15228146 TAGGAAAAGCAGGCAGAAGAAGG - Intergenic
970455410 4:16218517-16218539 TGGGATTAGCAACCAGAGGAAGG + Intronic
971001047 4:22322835-22322857 TGAGATAAGCAGATAAAAGACGG - Intergenic
971418326 4:26453585-26453607 TGGGATAGGCAGAGAGAGATGGG + Intergenic
972644975 4:40958983-40959005 TGGGATAGGCAGACAGCTGGAGG - Intronic
974539903 4:63220085-63220107 TGGGGTAAGCAGGCAAAGGCAGG + Intergenic
974823110 4:67093069-67093091 TGAAATGAGCAGAGAGAGGAGGG + Intergenic
976519200 4:86006752-86006774 GGGGATAAGCAAATAGATGAAGG - Intergenic
977536880 4:98263809-98263831 GGGGATAAGCAGAAACAGAAAGG + Intronic
979059583 4:116041019-116041041 GGAGATAACCATACAGAGGATGG + Intergenic
979318510 4:119296661-119296683 TGGAATAAAAAGGCAGAGGAAGG - Intergenic
979715457 4:123832204-123832226 TGGGAAAAGAAGAAAGAGGCAGG - Intergenic
979939221 4:126738924-126738946 TGGGATAGACAGTGAGAGGAAGG - Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
981220341 4:142225130-142225152 TGGAAAAAGCAGGCAGAAGAAGG + Intronic
981320832 4:143389212-143389234 TTGGTTAAAAAGACAGAGGAAGG - Intronic
981743170 4:148024362-148024384 TGAGATTAGCAGAGTGAGGAAGG + Intronic
983185109 4:164691890-164691912 TGTGATCAGTTGACAGAGGAAGG + Intergenic
983381179 4:166996264-166996286 TGGCATAATAAGACAGAGTAAGG - Intronic
984804794 4:183741792-183741814 TGGCACAAGCAGACAGAGAAAGG - Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985443292 4:190001035-190001057 TTGGATAAACAGGCAGAGGTTGG - Intergenic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985581220 5:696145-696167 TGGGAAGAGCAGACACAGCATGG + Intergenic
985595845 5:787477-787499 TGGGAAGAGCAGACACAGCATGG + Intergenic
986285345 5:6354669-6354691 TGGGAGAAGGAGGCAGAGGCTGG + Intergenic
986547315 5:8912505-8912527 TAGGAAAAGCAGGCAGAAGAAGG - Intergenic
986780506 5:11061121-11061143 TGGCAAAAAAAGACAGAGGAGGG - Intronic
986849147 5:11790777-11790799 TGGGACAATCTGACAGTGGAGGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987874460 5:23662338-23662360 TGGGCTATGCAGACCCAGGAAGG - Intergenic
987963603 5:24843120-24843142 TGAGATAAGAAGGCAGAGCATGG + Intergenic
989016934 5:36947387-36947409 GGGGAGAAAGAGACAGAGGATGG - Intronic
990047015 5:51445125-51445147 TGGGGGAAGCAGAGAGAGGGTGG - Intergenic
990477367 5:56174387-56174409 TGGGATAAGGGGGTAGAGGAAGG - Intronic
992565853 5:77994704-77994726 TGGGGTCAGGAGGCAGAGGAGGG - Intergenic
992565862 5:77994736-77994758 TGGGGTCAGGAGGCAGAGGAGGG - Intergenic
992565871 5:77994768-77994790 TGGGGTCAGGAGGCAGAGGAGGG - Intergenic
992565880 5:77994800-77994822 TGGGGTCAGGAGGCAGAGGAGGG - Intergenic
992622899 5:78611054-78611076 TGCTATAAGCAGACAGACAAAGG + Intronic
992933134 5:81671884-81671906 TGGGATAAGCAGAGAGAAAAGGG + Intronic
993515371 5:88827082-88827104 TGGCATAAGCAGGCAGATGAAGG + Intronic
994181238 5:96768731-96768753 TGGGCTAAGCAGACAGAAAAGGG - Intronic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
996012054 5:118491897-118491919 TGCAGTAAGCAGACAGAGCATGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996746640 5:126851899-126851921 TGGGGAAGGCAGACAGAGGTTGG - Intergenic
997226385 5:132212461-132212483 TGGCTTAGGCAGCCAGAGGATGG + Intronic
997450377 5:133977781-133977803 TGGGATGAGCAGGCTGAGGCAGG + Intronic
997472224 5:134123455-134123477 TGGGAAAAGGGCACAGAGGAGGG + Intronic
997849114 5:137315051-137315073 AGGGGTAAGCAGACAGGTGAGGG - Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
999098054 5:148998833-148998855 TGGAATAATCAGACAGAGTTGGG + Intronic
999215817 5:149934065-149934087 TGGTAAAAGTAGCCAGAGGATGG - Intronic
999487142 5:152008170-152008192 GGGGAGAGACAGACAGAGGAGGG - Intergenic
999505868 5:152195342-152195364 TGAGATCAGCAGAAACAGGAAGG + Intergenic
999957252 5:156716296-156716318 TGGGATAATAAGACAGTGGCAGG - Intronic
1001906192 5:175475644-175475666 TGGGAAAAGCAGATGGATGAAGG - Intergenic
1002004906 5:176224337-176224359 TGTGATAAGAAGACAGAGACTGG + Intergenic
1002221466 5:177686288-177686310 TGTGATAAGAAGACAGAGACTGG - Intergenic
1004490478 6:16110315-16110337 TGGCAAAAGCAGAAATAGGAAGG + Intergenic
1004583759 6:16979535-16979557 TGAGTAATGCAGACAGAGGAGGG - Intergenic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1005811199 6:29517756-29517778 CTGGATATGCAGACATAGGAAGG - Intergenic
1006181165 6:32154199-32154221 TGGGATAAGTAAACAGCGGGTGG + Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1008693297 6:54005184-54005206 TGGGAGATGGAGACAGAGGTGGG - Intronic
1011037566 6:82994518-82994540 TGGGACAGGCAAACAGAGGCAGG + Intronic
1011065576 6:83321932-83321954 TGGGGGAAGCTGCCAGAGGAAGG + Intronic
1013898922 6:115128697-115128719 TGGGATAAACAGAGACAGAATGG + Intergenic
1013951479 6:115787628-115787650 CTGGATAAGCATACAGAGTAAGG + Intergenic
1014255752 6:119158879-119158901 TAGGGCAACCAGACAGAGGAAGG - Intergenic
1014780394 6:125558708-125558730 TGGTCCAAGCAGACAGAGAAAGG + Intergenic
1014831195 6:126104760-126104782 TGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1015233197 6:130940044-130940066 TAGGATAAGCAGACTGAAAAAGG + Intronic
1016337064 6:143018434-143018456 TGGCATAAACAGAGAGAGGGAGG + Intergenic
1016665382 6:146633398-146633420 TGAGATAAGAAGCCAAAGGAGGG - Intronic
1017188215 6:151624002-151624024 GGGGAGAAGAAGACAGAGGTAGG - Intergenic
1018053332 6:160030444-160030466 TGGGATATGGAGACAGTGCAGGG + Intronic
1018274850 6:162119632-162119654 TGGCAAAAGAAGCCAGAGGAGGG - Intronic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1018576355 6:165264178-165264200 TGGCCTAAGCAAACAAAGGAAGG + Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1022640056 7:32173686-32173708 TGGGATAGGCAGATAGAAAATGG + Intronic
1023821438 7:43982871-43982893 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024883088 7:54111768-54111790 TGGGATGTGCAGAGACAGGAAGG - Intergenic
1024975496 7:55110456-55110478 TGGGAAAGGCGGACAGAGGCTGG + Intronic
1025008413 7:55374545-55374567 TGGGAAAAGCAGGCAGGGGTGGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1029494150 7:100888189-100888211 TGGGAGAAGAAAACAGAGGATGG + Intronic
1029749701 7:102536292-102536314 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1029767651 7:102635397-102635419 TGGGAGAGGCAGGCAGGGGATGG - Intronic
1030944762 7:115704383-115704405 TGGGGAAAGCAGAGACAGGAGGG - Intergenic
1031411472 7:121444760-121444782 TTGGCTAAGCATACAGAGAAGGG - Intergenic
1031496449 7:122454880-122454902 AGGGATAAGCAGATAGTGGCTGG - Intronic
1032741045 7:134739604-134739626 TGGGGAAAGGAGACAGATGATGG - Intergenic
1033010332 7:137615177-137615199 TGGGAGAAACACACAAAGGATGG - Intronic
1033128778 7:138727525-138727547 TGGCATAAGGAGACAGTGGGAGG + Intronic
1033439483 7:141365978-141366000 TGGGAGAGGCAGACAAAAGATGG - Intronic
1033483854 7:141768624-141768646 TGGGTTCAGAAAACAGAGGAGGG - Intronic
1034221432 7:149449439-149449461 AGGGAAAAGCAGACAGAGAAAGG + Intronic
1034513141 7:151552668-151552690 TGGCATCTGCAGTCAGAGGAGGG - Intergenic
1035899340 8:3441092-3441114 TGTGATATGAAGACAGAGGTAGG + Intronic
1036823179 8:11955805-11955827 TGGGAAAAGCAGACAGAGCACGG - Intergenic
1037149367 8:15617032-15617054 TGTAATCAGCAGACAGAGGGAGG + Intronic
1037993285 8:23335804-23335826 TGGGGTGTGAAGACAGAGGAAGG + Intronic
1038401728 8:27289028-27289050 AGGGATCAGCTGAGAGAGGAGGG + Intronic
1040004829 8:42611019-42611041 AGGGATGAACAGACAGAGCACGG + Intergenic
1040498898 8:47990492-47990514 TGGGATAAGGAGACAGTCGCAGG + Intergenic
1040682467 8:49829078-49829100 TGTGAGAAGCAGGCAGGGGATGG + Intergenic
1041441773 8:57904772-57904794 TGGGATATGCAGACTAAGGAGGG + Intergenic
1042203554 8:66305275-66305297 TGGGCTAAACAGAGATAGGAAGG - Intergenic
1042633323 8:70844681-70844703 TGGGAGAAGTACACAGATGACGG - Intergenic
1042711766 8:71725396-71725418 TGGGATAATAAGGAAGAGGAAGG + Intergenic
1043185084 8:77138182-77138204 TGAAAGAAGAAGACAGAGGAAGG - Intergenic
1043779912 8:84319511-84319533 TGTGATATTCAGACAGAGGAAGG + Intronic
1046139079 8:110065978-110066000 TGGCTTAAGGAGACAGAGGAAGG + Intergenic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1047248087 8:123161320-123161342 TGGGAGAAGGAGGCAGATGAAGG - Intergenic
1047253085 8:123195247-123195269 TGGGATAAGCTGGGAGTGGAAGG + Intronic
1047319524 8:123766606-123766628 TGAGAAAAGCAGACACATGAAGG - Intergenic
1047625552 8:126652508-126652530 TGGGAAAAACAGCCAAAGGAGGG + Intergenic
1048381985 8:133873535-133873557 TGGAGCAAGGAGACAGAGGAAGG - Intergenic
1048878833 8:138857142-138857164 TGGGGTCAGCAGATAGAGGTAGG - Intronic
1049312101 8:141938680-141938702 TGGGATGACCACACAGGGGATGG + Intergenic
1050667537 9:7958058-7958080 TGAGAAAAACAGACAGATGAAGG - Intergenic
1051379625 9:16442620-16442642 TGGGATAATCAGACTGTCGAGGG + Intronic
1051394970 9:16609954-16609976 TGTGATTATCAGACAGAAGATGG - Intronic
1051990148 9:23143187-23143209 TGTGAGAAACAGACAGAGGCAGG + Intergenic
1053897025 9:42753112-42753134 TGAGGTATGCAGACAAAGGAAGG + Intergenic
1055360122 9:75480722-75480744 CAGGATAGGCAAACAGAGGAGGG + Intergenic
1056002801 9:82234847-82234869 TGGGATATTCAAACAGATGATGG - Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057140059 9:92721017-92721039 TGGGACCAGCAGACACAGCAAGG + Intronic
1058003568 9:99892129-99892151 TGGGATAAGAGGAGAGAGGGTGG + Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1060416388 9:123433817-123433839 TGGGGAAAGCAGTCAGGGGAAGG - Intronic
1061671069 9:132188453-132188475 TGGGATAAGAAGCCAGGGGATGG - Intronic
1185807709 X:3075706-3075728 AGAGACAAGCAGACAGAGAAAGG - Intronic
1185958496 X:4519254-4519276 TGGAAAAAGCAGTCAGAAGAAGG - Intergenic
1185968791 X:4638480-4638502 TGGGATGAGCATATAAAGGAGGG + Intergenic
1186288477 X:8070979-8071001 GGGGATAAGCAGAGAGGGAATGG - Intergenic
1188122340 X:26323623-26323645 TGAGATACACATACAGAGGAAGG + Intergenic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1190969834 X:55337779-55337801 TGGGATGAGCAGTCAAGGGAAGG + Intergenic
1195022594 X:100844901-100844923 AGGGATAAGCTCACAGTGGATGG - Intronic
1195087403 X:101425368-101425390 TGTGGTTAGCAGAGAGAGGAAGG + Intronic
1195123969 X:101786682-101786704 TAGAAAAAGCAGACAGAAGAAGG - Intergenic
1195624744 X:106996525-106996547 AGGGTTAAGCAGCCAGAGGTAGG - Intronic
1195828070 X:109024686-109024708 GGGATTAAGCTGACAGAGGAAGG - Intergenic
1195881143 X:109593741-109593763 TGGGACAAAAAGAGAGAGGAAGG + Intergenic
1198230449 X:134684099-134684121 TGGGAGAAGGAGACTGAGAATGG + Intronic
1198861253 X:141072971-141072993 TGGTATAAGCATACAGACAAAGG + Intergenic
1198901439 X:141514408-141514430 TGGTATAAGCATACAGACAAAGG - Intergenic
1199192748 X:144990423-144990445 GGGGCTAAGTATACAGAGGAGGG + Intergenic
1199269432 X:145865395-145865417 TGGGAGAAGCATACATAGCAAGG + Intergenic
1199474313 X:148229068-148229090 TGGGACAAAGGGACAGAGGATGG - Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199778318 X:151034979-151035001 TGGGGTACCCTGACAGAGGATGG - Intergenic
1199974568 X:152885524-152885546 TGGGAGAGGGAGTCAGAGGAGGG - Intergenic
1200181390 X:154152914-154152936 TGGGGAGAGCAGACAGATGAGGG - Intronic
1200187036 X:154190028-154190050 TGGGGAGAGCAGACAGATGAGGG - Intergenic
1200192685 X:154227166-154227188 TGGGGAGAGCAGACAGATGAGGG - Intronic
1200198440 X:154264970-154264992 TGGGGAGAGCAGACAGATGAGGG - Intronic
1200258358 X:154597946-154597968 TGGGATGAGGAAACAGAGTAAGG - Intergenic