ID: 1173441981

View in Genome Browser
Species Human (GRCh38)
Location 20:43085884-43085906
Sequence CAGAGCGCTAAGGATCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173441976_1173441981 19 Left 1173441976 20:43085842-43085864 CCTTAAGCTTACAATCTAAGAAC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1173441981 20:43085884-43085906 CAGAGCGCTAAGGATCCTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 57
1173441975_1173441981 20 Left 1173441975 20:43085841-43085863 CCCTTAAGCTTACAATCTAAGAA 0: 1
1: 0
2: 2
3: 23
4: 243
Right 1173441981 20:43085884-43085906 CAGAGCGCTAAGGATCCTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 57
1173441974_1173441981 21 Left 1173441974 20:43085840-43085862 CCCCTTAAGCTTACAATCTAAGA 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1173441981 20:43085884-43085906 CAGAGCGCTAAGGATCCTAAGGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173441981 Original CRISPR CAGAGCGCTAAGGATCCTAA GGG Intronic
902519251 1:17006661-17006683 CAGAGCTCCAAGGAAGCTAATGG - Intronic
913220609 1:116657434-116657456 CACAGGGCTAAGCAACCTAATGG + Intronic
915829545 1:159113977-159113999 CAGAAAGCTAAGGATTTTAATGG - Intronic
924450015 1:244169586-244169608 AAGAGCGGTAAGGACCCTGATGG - Intergenic
1063151642 10:3342421-3342443 TAGATTGCTAAGGATACTAAAGG + Intergenic
1080650959 11:34222474-34222496 CAGAGCCCTAAGCATCCGAGTGG + Intronic
1084311515 11:68318971-68318993 CAGAGGCCTCAGGATCCTGAAGG - Intronic
1085475456 11:76786103-76786125 CAGAGCCCTAAGCATCCTGCAGG + Intronic
1092114860 12:5992958-5992980 CAGAGCCCTAAGGAACCTACAGG + Intronic
1092164180 12:6332947-6332969 CAGAGTGCTCAGGGTCCTACTGG - Intronic
1095949100 12:47772187-47772209 CACAGCACTAAGGATCCACATGG - Intronic
1096455379 12:51780710-51780732 CAAAGCTCTTAGGGTCCTAAGGG - Exonic
1130787944 15:87121008-87121030 CAGAGCATTGAGGATCCAAAGGG - Intergenic
1139894885 16:70280579-70280601 CAGAGTGAGAAGCATCCTAAGGG + Intronic
1139969718 16:70766222-70766244 CAGTGCACTAAGAATCCAAAAGG + Intronic
1146188515 17:30744624-30744646 CAGAGCTCTTGGGATCCTCAGGG + Intergenic
1146333388 17:31948937-31948959 CAGAGCTCTTGGGATCCTCAGGG + Intronic
1149518005 17:57294966-57294988 CAGCGGGCGAAGGATGCTAAAGG + Intronic
1156312963 18:35941662-35941684 CAAAGGGCTAAGGAACCTAGAGG + Intergenic
1159260818 18:66009898-66009920 CAGAGCCCAAAGGATCTTCAGGG + Intergenic
1168041588 19:53763355-53763377 CTGAGCTCAAGGGATCCTAAAGG + Intergenic
929441927 2:41971522-41971544 CAGAGCACTGAGGATCATCAAGG + Intergenic
937642572 2:124230195-124230217 CAAATTGCTAAGGACCCTAAAGG + Intronic
940294336 2:152106669-152106691 CAGAGCCAAAAGGAGCCTAAGGG + Intergenic
941974215 2:171385713-171385735 CAGAGCCCTAAGGGTCCTCTTGG + Intronic
946411393 2:219516967-219516989 CAGAGCCCTATGGATCCCAAAGG - Intronic
1173441981 20:43085884-43085906 CAGAGCGCTAAGGATCCTAAGGG + Intronic
1180822144 22:18837656-18837678 CACAGGGCTAAGCAACCTAATGG + Intergenic
1181190830 22:21138390-21138412 CACAGGGCTAAGCAACCTAATGG - Intergenic
1181208375 22:21272117-21272139 CACAGGGCTAAGCAACCTAATGG + Intergenic
1181810038 22:25398419-25398441 CAGAGGCCTCAGGATCCTGAAGG + Intronic
1184569729 22:45314596-45314618 CAGAGCGGGCAGGATCTTAAAGG - Intronic
1203218556 22_KI270731v1_random:23295-23317 CACAGGGCTAAGCAACCTAATGG - Intergenic
1203272276 22_KI270734v1_random:63541-63563 CACAGGGCTAAGCAACCTAATGG + Intergenic
949366784 3:3290375-3290397 CAGTGTGCTAAAGATCCTGATGG - Intergenic
950660080 3:14461782-14461804 CAGGGCGCTGAGGATCCTTAGGG + Intronic
952955509 3:38554831-38554853 CAGTGTGCTAAGGATGCTCAGGG - Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
955811442 3:62794961-62794983 CAGAGCGCTATGGGTTCTCAGGG + Intronic
958484723 3:94690248-94690270 AAGAGAGCTAAGGATCTTATGGG - Intergenic
963611145 3:147470617-147470639 CAGCGTGTTAAGGATCCAAAGGG - Intronic
966883913 3:184364172-184364194 CAAAGCGCTAAAGATTCTGAGGG - Intronic
979216552 4:118171360-118171382 CTGAGCATTAAGCATCCTAAGGG - Intronic
979672745 4:123377922-123377944 CAGGGTGCAAAGGGTCCTAACGG - Intergenic
987975624 5:25011382-25011404 CATATCACAAAGGATCCTAAAGG + Intergenic
989582302 5:43044476-43044498 CAGAGCCCACAGGATCCTACAGG + Intergenic
990259046 5:54001333-54001355 CAGAGTGCTAAGGATGCAGAAGG + Intronic
991387000 5:66101420-66101442 CATAGAGCTAAGGACCCTCATGG + Intergenic
1009812683 6:68689208-68689230 AAGAGAGCTCAGGGTCCTAAAGG + Intronic
1015605570 6:134951955-134951977 CAGAGTGCAAAAGATTCTAATGG + Intergenic
1026642498 7:72139730-72139752 CAGAGCACTGAGGTTCCTAGAGG - Intronic
1027583753 7:80030949-80030971 CATAGCGCAAAGGATCTTTATGG + Intergenic
1034305878 7:150044768-150044790 CAAAGCCCTAAGGATTATAAAGG + Intergenic
1038175715 8:25180920-25180942 CAGAGCGCTTTAGCTCCTAAGGG + Intergenic
1046517977 8:115288148-115288170 AAGAGTTCTAAGTATCCTAATGG - Intergenic
1049072492 8:140367594-140367616 CAGAGCACAAAGGATCTTCACGG + Intronic
1049703259 8:144024428-144024450 CAGAGGGAAGAGGATCCTAAGGG - Intronic
1060041189 9:120303081-120303103 CAGGAAGCTAAGGATCCTAGAGG + Intergenic
1186689250 X:11957469-11957491 CAGGGCTCTAAGGATCCTCCTGG - Intergenic
1191110837 X:56802337-56802359 CAGAGGGCCAAGGGTCCCAAGGG - Intergenic
1201652209 Y:16302163-16302185 CAAAGCTCTAAACATCCTAATGG - Intergenic