ID: 1173443561

View in Genome Browser
Species Human (GRCh38)
Location 20:43098033-43098055
Sequence CCTTCCTCACGTGGCTTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173443561_1173443573 30 Left 1173443561 20:43098033-43098055 CCCCCGAAGCCACGTGAGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1173443573 20:43098086-43098108 AGTAGAGAAACAGAGCCAGCCGG 0: 1
1: 0
2: 4
3: 51
4: 505
1173443561_1173443567 -9 Left 1173443561 20:43098033-43098055 CCCCCGAAGCCACGTGAGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1173443567 20:43098047-43098069 TGAGGAAGGCCAGAACACCAAGG 0: 1
1: 0
2: 0
3: 20
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173443561 Original CRISPR CCTTCCTCACGTGGCTTCGG GGG (reversed) Intronic
902926340 1:19698231-19698253 CCTTCCTCACATGGCACCTGGGG + Intronic
913183474 1:116344962-116344984 CCTTCCTGATGTGGCTTAGTTGG + Intergenic
915995248 1:160555714-160555736 CCTTCCTCACATAGCTACAGTGG - Intronic
917522920 1:175762945-175762967 CCTTCCTCCAGTGCCTTCAGAGG + Intergenic
924014847 1:239709994-239710016 CCTTCCTCATTTGGCATAGGTGG - Intronic
924506905 1:244694711-244694733 CCTTCGTCACCTTGCTTCTGTGG + Intronic
1062840392 10:666064-666086 CCCTCCACGCGTGGCTACGGTGG + Intronic
1064998301 10:21315382-21315404 CCTTCCTCAGGCAGCTTCGATGG + Intergenic
1066126585 10:32347621-32347643 CCGCCCCCACGGGGCTTCGGAGG + Intronic
1067236764 10:44457749-44457771 CCTTGCTCACCTGGCTGAGGGGG - Intergenic
1072550275 10:96472041-96472063 CCCTCCTCACCTAGCTTTGGAGG + Intronic
1076489306 10:130846126-130846148 CCTTCCTCACAGGGCTGCTGTGG - Intergenic
1079389480 11:20009039-20009061 CCATCCTCACGTGGCTACACAGG + Intronic
1088982802 11:114878826-114878848 CTTTCCTCACTTGGCTTCCAGGG - Intergenic
1089128276 11:116192777-116192799 CCCTCCTCCAGTGGCTTCAGTGG + Intergenic
1090967737 11:131613440-131613462 CCATCCTCAGGTGGCTCCTGGGG + Intronic
1091555246 12:1568221-1568243 CCTTGCTCACCTGGTTTCTGAGG - Intronic
1091750311 12:3018094-3018116 CCTTCCCCACGTGCCTAGGGCGG - Intronic
1096650502 12:53059910-53059932 CCTTCCTCGCCTGCCTTGGGTGG - Exonic
1109597339 13:64573398-64573420 TCTTGCTCACGTGGTTTCTGAGG + Intergenic
1109649670 13:65309848-65309870 CCTTCAACACCTGGCTTCAGAGG + Intergenic
1113824840 13:113243924-113243946 CCATCGTCAGGTGGCTTGGGAGG - Intronic
1117662413 14:58021230-58021252 CTATCCTCACATGGCTTGGGAGG + Intronic
1118012737 14:61626526-61626548 CCTTCCTCACTTGGCCCCAGAGG - Intronic
1121790968 14:96699367-96699389 CCTTTCTCACGGGGCTGCCGTGG - Intergenic
1124350824 15:28954472-28954494 CCTTCTGCAGGTGGCTTCTGCGG + Intronic
1124665539 15:31588737-31588759 TCTTCCACACGTGGCTTCCAAGG + Intronic
1132872718 16:2122909-2122931 CCTTTCTCCCGTGGCCTGGGTGG - Intronic
1133026560 16:2991260-2991282 TCTGCCTCACCTGGCTTCGGAGG - Intergenic
1133305412 16:4805166-4805188 TCTTCCTCACATGGGGTCGGGGG - Exonic
1133365383 16:5204961-5204983 TCTTCAGCACGTGGCTTCTGAGG - Intergenic
1134109908 16:11508749-11508771 CCTTACTAATGTGGCTGCGGTGG + Exonic
1134259952 16:12643144-12643166 CCTTCCACACGGTGCTTCGAGGG + Intergenic
1134519015 16:14910011-14910033 CCTTCCCCATGTGGCTTCCAAGG + Intronic
1134551805 16:15142088-15142110 CCTTTCTCCCGTGGCCTGGGTGG - Intergenic
1134554913 16:15156213-15156235 CCTTCCCCATGTGGCTTCCAAGG - Intergenic
1134706685 16:16308666-16308688 CCTTCCCCATGTGGCTTCCAAGG + Intergenic
1134960855 16:18403458-18403480 CCTTCCCCATGTGGCTTCCAAGG - Intergenic
1137610645 16:49815001-49815023 CCTCCCCGACGTGGCTTGGGAGG - Intronic
1138769556 16:59647855-59647877 CCTTCCTCACATGGCAGCAGGGG + Intergenic
1142967779 17:3591907-3591929 CCTTCCTCATGTGACCTCGTGGG - Intronic
1144629659 17:16864532-16864554 CCTTCCTCACAGGGCTGTGGTGG + Intergenic
1144651769 17:17011585-17011607 CCTTCCTCACAGGGCTGTGGTGG - Intergenic
1144788046 17:17842673-17842695 CCTTCTCCAAGTGGCTTGGGAGG - Intergenic
1151551228 17:74823632-74823654 CCTTCCCCATGTGGATTCAGAGG - Intronic
1152014516 17:77741708-77741730 TCTTTCTCACCTGGCTTCTGAGG + Intergenic
1154374610 18:13798813-13798835 CCCTCCTCCCTTGGCTTCTGCGG + Intergenic
1155152608 18:23135185-23135207 CCTCCCGCACCTGGCTTCCGCGG + Intronic
1160951416 19:1669344-1669366 CCTTCCTCACCTGGCCTGGGGGG + Intergenic
1161187787 19:2933839-2933861 GCGTCCTCACGTGGATTCGAAGG + Exonic
1161499553 19:4606460-4606482 CCTTTCTCACGGGGCTTCTTGGG - Intergenic
1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG + Exonic
1167327214 19:48834160-48834182 CCTTCCTCTCCTGGCTCCGCTGG - Intronic
1167843779 19:52143030-52143052 CCTTCGTCATCTGGCTTCTGCGG - Intergenic
925694868 2:6566139-6566161 CCTTCCTCAGATGGCCTCTGAGG + Intergenic
927957413 2:27217473-27217495 CCGTCCTCACGTGGTTCCAGTGG + Exonic
932456114 2:71851092-71851114 CATTCCTCACCTGGTCTCGGAGG + Intergenic
933831767 2:86217033-86217055 TCTCACTCACGTGGTTTCGGTGG + Exonic
937431589 2:121843258-121843280 CTTTCCTCACTTGGTTTCCGGGG + Intergenic
940948224 2:159643332-159643354 CCTTCCTAACATGGCATAGGGGG + Intergenic
943760731 2:191605965-191605987 CCTTCATCAAGTGGCTCCTGAGG - Intergenic
948953833 2:241272416-241272438 GCCTCCTCCCGGGGCTTCGGTGG - Intronic
1170666097 20:18387513-18387535 TCTTCCTCACCTGGCTACTGGGG + Intronic
1171564479 20:26167854-26167876 CCCTCCTCATGTGGCTGCTGAGG - Intergenic
1173443561 20:43098033-43098055 CCTTCCTCACGTGGCTTCGGGGG - Intronic
1176074836 20:63243729-63243751 CCTTCCTCCCGTGGCCACTGCGG + Intronic
1179482266 21:41685786-41685808 CCACCCACACCTGGCTTCGGTGG + Intergenic
1179678551 21:43001489-43001511 CCTTCTCCACGAGGCTTTGGGGG + Intronic
1180706814 22:17815325-17815347 CCTCCCTCACGTTGCTGTGGTGG - Intronic
1181595359 22:23911064-23911086 CCCAACTCACGTGGCTTTGGGGG - Intergenic
1184488555 22:44796017-44796039 CCCTCCTCACCTGGCTTCCCAGG + Intronic
949977502 3:9474503-9474525 CCACCCTCACGCTGCTTCGGAGG - Exonic
950609925 3:14119858-14119880 CCTACCTCACGTGGTTGGGGAGG + Intronic
953575944 3:44113361-44113383 GCTTCCTCCCCTGGCTTCAGCGG - Intergenic
954110411 3:48429962-48429984 CCTTCCTTACCCGGCTCCGGTGG + Intronic
962986364 3:140539870-140539892 CCTTCCTTACTTGGCTGAGGTGG - Intronic
967100960 3:186215453-186215475 CCATCCTCAAGTGGCTGGGGAGG + Intronic
970687620 4:18586612-18586634 TCTTCCTCACCTGGCATTGGAGG + Intergenic
979483835 4:121248331-121248353 CCCTCCTCACTTGGCTTCCAGGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
985810868 5:2083645-2083667 CCTCCCTCACCTGGCTGAGGTGG - Intergenic
987004405 5:13695184-13695206 CATTAGTCACGTGGCTTTGGAGG - Intronic
987305304 5:16631999-16632021 CCTTCCTCACTTGGCAGCTGGGG + Intergenic
989957369 5:50373016-50373038 CCTTCCTCGAGTGGCTATGGAGG + Intergenic
996398392 5:123035524-123035546 CCGTCCTCAGGTGGCGTCTGCGG + Intronic
997767015 5:136514749-136514771 CCTTCCTCCTGTGGCTTAGGTGG - Intergenic
999770664 5:154773337-154773359 CCTTCCTAAGGTGGCTTTGAGGG - Intronic
1000931105 5:167252489-167252511 CCTTCATCATGTGTCTTTGGAGG + Intergenic
1013684965 6:112570087-112570109 CTTTCATCACGTGGCTATGGTGG + Intergenic
1016867123 6:148778576-148778598 CCTGCCTGACGTGGCCTGGGAGG - Intronic
1022656770 7:32326505-32326527 CCTTCTTCACCTGGTTTCCGAGG - Intergenic
1025273253 7:57546365-57546387 CCCTCCTCATGTGGCTGCTGAGG + Intergenic
1026805886 7:73429489-73429511 CCTTCCTCTGGCAGCTTCGGTGG - Intergenic
1035179424 7:157078354-157078376 CCTTCCTCGCGTGGCTTCCCGGG + Intergenic
1035411275 7:158644611-158644633 CCTTCCTCTCATGGCTTCATGGG - Intronic
1037079575 8:14767248-14767270 GCTTCCTTATGTGGCTTCAGGGG - Intronic
1037681287 8:21099743-21099765 CCTTCCTCACCTGGTCTCTGGGG + Intergenic
1042024987 8:64413773-64413795 CCTTCCTCATGTGTCTACAGTGG + Intergenic
1042249298 8:66739803-66739825 CCTTCTTCACATGGCATCAGGGG + Intronic
1049460700 8:142726463-142726485 CCTTCCTGACGAGGCTGGGGAGG - Intergenic
1049936631 9:505701-505723 CTTTCCGCACGTGGCCTCTGCGG + Intronic
1049988928 9:974970-974992 CCTACCCCACGCGGCTTTGGAGG + Intergenic
1056013409 9:82356353-82356375 GCTTCCCCACCTGGCTTCAGGGG - Intergenic
1059677092 9:116549789-116549811 CCTGCCTCACATGGCATCTGAGG + Intronic
1203624934 Un_KI270750v1:6991-7013 CCCTCCTCATGTGGCTGCTGAGG + Intergenic
1187415587 X:19090435-19090457 CCTCCCTCACGTGGCTGCGCAGG + Intronic
1190286167 X:48962663-48962685 CCTTCCTCCCCTGGCGGCGGTGG - Exonic
1201743993 Y:17351265-17351287 CCTTCCTCAAGTGGCTACAAGGG - Intergenic