ID: 1173443616

View in Genome Browser
Species Human (GRCh38)
Location 20:43098453-43098475
Sequence TAGTTACCTGGCACTCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173443616 Original CRISPR TAGTTACCTGGCACTCTTAG GGG (reversed) Intronic
902117808 1:14136363-14136385 TAGTTCCCTGACACTCTGTGAGG - Intergenic
911310990 1:96291847-96291869 TATTTACCTGGCACTGTTTTAGG - Intergenic
916013234 1:160725559-160725581 TGGTTACCTGACATTCCTAGGGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923968559 1:239172997-239173019 TAGTTACTTCTCACTCCTAGTGG - Intergenic
1062926315 10:1317961-1317983 CAGTTACCTGGCACTCACACCGG - Intronic
1071286797 10:84156128-84156150 TAGATACCTGGGATTCCTAGAGG + Intergenic
1072144650 10:92624053-92624075 TAGTCACCTGGGCCTCTTTGAGG - Intronic
1073035191 10:100559851-100559873 TAGTTACGTGGTACTTGTAGAGG - Exonic
1076673405 10:132135476-132135498 GAGTTACCTGGAAATCTCAGTGG - Intronic
1078865150 11:15290101-15290123 TAGTTATCTGGTCCTCATAGTGG + Intergenic
1079435553 11:20444323-20444345 TATGTACCTGGCACTCTTCTAGG + Intronic
1084908445 11:72367589-72367611 TAGACACCAGGAACTCTTAGAGG + Intronic
1088636396 11:111825091-111825113 TTGTAACCTGGTACTCTTACTGG + Intronic
1089835706 11:121368620-121368642 TAGTTATCTGAGAATCTTAGGGG + Intergenic
1091308369 11:134555434-134555456 CAGTTACCTGTGACTCATAGTGG - Intergenic
1091327338 11:134701047-134701069 TAGGTTCCTGTCACTCTCAGTGG - Intergenic
1092525715 12:9308907-9308929 TAGTGACCAGGCATCCTTAGTGG - Intergenic
1092541572 12:9422908-9422930 TAGTGACCAGGCATCCTTAGTGG + Intergenic
1094511470 12:31099594-31099616 TAGTGACCAGGCATCCTTAGTGG - Intronic
1094756218 12:33471750-33471772 CAGATACCTATCACTCTTAGAGG - Intergenic
1096772524 12:53945157-53945179 TGGTTACCTGGCGCTCAGAGAGG - Exonic
1105338121 13:19493904-19493926 TAGTTACCTGACCCTTTTTGTGG - Intronic
1108771407 13:53705470-53705492 GTGTTTCCTGGCACTCTTAGAGG - Intergenic
1111335468 13:86815843-86815865 AAGTTGCCTGGGACTCATAGAGG + Intergenic
1112679535 13:101747015-101747037 TAGTTACCAGGCAAACCTAGAGG - Intronic
1114370432 14:22081316-22081338 TAGTTTCCTGGCACACATAAAGG + Intergenic
1125703593 15:41710838-41710860 TACATAACTGGTACTCTTAGTGG - Exonic
1126380793 15:48044651-48044673 GAGGTACCTGGCACTGCTAGGGG + Intergenic
1128053060 15:64680510-64680532 TAGGTATCTTGCACTTTTAGGGG + Intronic
1132020624 15:98358876-98358898 TAGTCACCTGGCATTCCTGGGGG - Intergenic
1138098883 16:54235607-54235629 TGGTGAACTGGCACTCTTCGTGG + Intergenic
1140238690 16:73181903-73181925 AAGTTACCTGTCCCTCTTGGTGG - Intergenic
1141827698 16:86492801-86492823 GAGTTTCCTGCCACTCTGAGAGG - Intergenic
1143361951 17:6378888-6378910 TAATCACCTTGAACTCTTAGAGG + Intergenic
1151177792 17:72302782-72302804 TAATTTCCTGGCCCCCTTAGAGG - Intergenic
1151920935 17:77155063-77155085 TAGCTATCTGGCTCTCTTACTGG + Intronic
1155273293 18:24161896-24161918 CAGTTACCTGGCATGCATAGTGG - Intergenic
1164975510 19:32570101-32570123 TTGGTACCTGGCACACTTAATGG - Intergenic
1166731582 19:45062038-45062060 TAGGTACCTGGCACAGTGAGGGG - Intronic
928310674 2:30207097-30207119 TAGCTACCTGACACTTTTGGTGG - Intergenic
941516374 2:166485416-166485438 TGGTTATCTGGCACTGTTTGTGG - Intronic
1169646937 20:7822069-7822091 TAGTTACCTGGGTCTCTTCATGG + Intergenic
1173443616 20:43098453-43098475 TAGTTACCTGGCACTCTTAGGGG - Intronic
1175261854 20:57679722-57679744 TGGTCACCTGGCACTGTGAGTGG + Intronic
1176735447 21:10541970-10541992 TAGTTACCTGACCCTTTTTGTGG + Intronic
1176931668 21:14819558-14819580 TATGTACCTGGCACTGTTATAGG - Intergenic
1182728845 22:32471295-32471317 TAGTTAGCTGGGACTGTAAGTGG + Intergenic
1183533689 22:38381393-38381415 TAGTTACCTGACCCTTTTTGTGG - Intronic
957162055 3:76622817-76622839 TAGTTTCTTGGCACTCTTTTGGG - Intronic
960570513 3:119180845-119180867 TGCTTTCCTGGCACACTTAGAGG - Intronic
961706478 3:128790423-128790445 TACTTAACTGTGACTCTTAGAGG - Intronic
962070328 3:132027116-132027138 TAGGTACCTAGCACTGTTTGGGG + Intronic
963458848 3:145579784-145579806 TGGTCACCTGACATTCTTAGTGG + Intergenic
965134828 3:164750404-164750426 TAATTACGTGGCACTGTCAGTGG + Intergenic
972693909 4:41425862-41425884 TAGTTTCATGGCTGTCTTAGAGG + Intronic
972783035 4:42302274-42302296 GAGACACCTGGCACTCTCAGAGG + Intergenic
973708072 4:53599642-53599664 TAGTCAACTGGCACTGTTACAGG - Intronic
974310016 4:60193246-60193268 TACTTACCTATCACTCTTAAAGG - Intergenic
975229957 4:71921580-71921602 TAGTTACCTGGCACAGTTCTAGG - Intergenic
986165180 5:5266787-5266809 TCGTTTACTGTCACTCTTAGTGG + Intronic
993562979 5:89434873-89434895 GAGTTCCCTGGCATTCTTAAAGG + Intergenic
995791079 5:115887823-115887845 TAGATACCTGTTACTCTTTGTGG + Intronic
997389412 5:133501721-133501743 TTGTTACATGGCACTGTTATGGG + Intronic
999457721 5:151731790-151731812 TAGTTATATGTCACACTTAGGGG + Intergenic
1000715100 5:164632645-164632667 TAATTAGCTGGCATTCTTAAAGG + Intergenic
1001749433 5:174117704-174117726 TGGTTTCCTGGCAATCTTTGGGG - Intronic
1002006946 5:176242786-176242808 TATATACCAGGCACTCTTAGAGG + Intronic
1002219432 5:177667844-177667866 TATATACCAGGCACTCTTAGAGG - Intergenic
1003634327 6:7818547-7818569 GAGTGGCCTGGCACTTTTAGAGG + Intronic
1006652344 6:35562071-35562093 AAGTTATCTGGTACTCTTTGTGG + Intergenic
1012934867 6:105356491-105356513 CAGATACCTGAAACTCTTAGTGG + Intronic
1013494422 6:110684146-110684168 TAATTACCTGGAATTCTGAGGGG + Intronic
1018320504 6:162603206-162603228 TTGTTACCTGCCACTTTTAGAGG - Intronic
1022659667 7:32355099-32355121 TAGTTACCTGGGACCCTTCTAGG - Intergenic
1032886011 7:136139071-136139093 TAGTTTACCGGCAATCTTAGTGG + Intergenic
1043408708 8:79968622-79968644 TAGATACCTGACAGTCTTAAAGG - Intronic
1044375383 8:91464169-91464191 TAGTAACCTGGCACCCTTGTGGG - Intergenic
1047871819 8:129091449-129091471 TGGTTACCTGACATTCCTAGGGG + Intergenic
1051007369 9:12362538-12362560 TAGATACCTGGCCCTCTTTGGGG - Intergenic
1055567750 9:77585984-77586006 TATTTTCCAGGCAGTCTTAGTGG + Intronic
1058399879 9:104603269-104603291 TACCTACCTGGAATTCTTAGTGG + Intergenic
1059599443 9:115760475-115760497 CAGGTACTTGGCACTCTAAGGGG + Intergenic
1059924755 9:119197535-119197557 TAGTAACTTGCAACTCTTAGTGG - Intronic
1193836160 X:86347091-86347113 TAGTTACTAGGCAGTCTTAAAGG + Intronic
1194102107 X:89718217-89718239 TAGTTACCTGGCACTCAGGTTGG - Intergenic
1196360068 X:114842833-114842855 TGGTTACCTAGCACTTTTACAGG - Intronic
1198609096 X:138377592-138377614 AAGGTACCTGGCACTTTTTGTGG - Intergenic
1202593444 Y:26511494-26511516 TAGTTACCTGACCCTTTTTGTGG + Intergenic