ID: 1173444594

View in Genome Browser
Species Human (GRCh38)
Location 20:43106273-43106295
Sequence CATTTGCACTGAAAAGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173444594_1173444597 7 Left 1173444594 20:43106273-43106295 CCCCATGCTTTTCAGTGCAAATG 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1173444597 20:43106303-43106325 AAATAACAAAAAGAAAGTAAAGG 0: 1
1: 1
2: 57
3: 1147
4: 8704
1173444594_1173444598 8 Left 1173444594 20:43106273-43106295 CCCCATGCTTTTCAGTGCAAATG 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1173444598 20:43106304-43106326 AATAACAAAAAGAAAGTAAAGGG 0: 1
1: 2
2: 42
3: 826
4: 7326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173444594 Original CRISPR CATTTGCACTGAAAAGCATG GGG (reversed) Intronic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
902365542 1:15970952-15970974 GCTTTCTACTGAAAAGCATGTGG + Intronic
904313721 1:29646360-29646382 AAGTGGCACTGAAAAGCTTGTGG + Intergenic
908755248 1:67463758-67463780 GATTTGCAATGAAAAGCAGCTGG - Intergenic
909446369 1:75753527-75753549 GATCTTCACTGAAAAGCATTAGG - Intronic
914352555 1:146853231-146853253 CATTTGCAGTGAGAGGCAGGTGG - Intergenic
916856377 1:168754494-168754516 CATTTGGACTGAAAAGTATTGGG + Intergenic
918582065 1:186143063-186143085 AATTTGCACTAAAAAGTATTTGG - Intronic
920592986 1:207240148-207240170 CTGAAGCACTGAAAAGCATGCGG + Intergenic
923923118 1:238591939-238591961 CACTTTCTCTGAATAGCATGTGG + Intergenic
1063718581 10:8555288-8555310 CCTTTGAACTGAAAAGCCTTAGG + Intergenic
1065551195 10:26870011-26870033 CATTTGCTCTGGAGAGAATGTGG + Intergenic
1066254660 10:33666774-33666796 CATTAGCACTGGAAAGCTCGTGG - Intergenic
1068789851 10:61016137-61016159 CATTTACACTGAGAATCCTGAGG + Intergenic
1068965832 10:62911421-62911443 GATCTGCACAGAAAAGCTTGAGG - Intronic
1070164406 10:73887143-73887165 CTTTTTCACTCAGAAGCATGAGG + Intergenic
1071122413 10:82294670-82294692 CATTTGGAGAGAAAATCATGTGG - Intronic
1071136649 10:82461481-82461503 CATGTGCAATGATAAGAATGTGG - Intronic
1075042635 10:119120540-119120562 CATTTGCTATAAATAGCATGTGG + Intronic
1076182078 10:128417774-128417796 CTTGTCCACTGAAAAGCATCAGG - Intergenic
1077858118 11:6149656-6149678 CATTTTCACTGATAAGCCTGTGG - Intergenic
1078976405 11:16483662-16483684 CATTTGCAATGAAAAAAATGAGG + Intronic
1079373407 11:19871321-19871343 CATTTACACTGGAAGGAATGAGG - Intronic
1080803883 11:35634230-35634252 CAGTTGCACAGGAAAGCTTGTGG + Intergenic
1080928130 11:36779628-36779650 ATTTTGGACTGTAAAGCATGTGG + Intergenic
1083959106 11:66004156-66004178 TTTGTGCACTGAAAAGCAAGTGG + Intergenic
1085981479 11:81731485-81731507 GATTTCCACTGAAAAGTCTGCGG + Intergenic
1087403661 11:97701183-97701205 AATTTTCAATGAAAAGCATAAGG - Intergenic
1087531855 11:99392942-99392964 CATTGGCTTTGAATAGCATGTGG + Intronic
1087619635 11:100527016-100527038 CATTTGCAGTGACCTGCATGAGG + Intergenic
1089482979 11:118821979-118822001 CATTTTCAATGAAAAACACGTGG + Intergenic
1090154118 11:124419603-124419625 CAATTTCACAGAATAGCATGTGG - Intergenic
1090813155 11:130265473-130265495 CATTTAAAGTGAAAAACATGAGG - Intronic
1091151900 11:133336778-133336800 CATTTGTTATGAAAAGAATGAGG + Intronic
1091860657 12:3779576-3779598 CATTTGCACTTAAAAACATCAGG + Intergenic
1093004082 12:14033397-14033419 GATTTGCAGTGTAAAGCAAGCGG + Intergenic
1093119989 12:15257922-15257944 CATATGCACTACTAAGCATGGGG - Intronic
1093774331 12:23054656-23054678 CATTTATCCTAAAAAGCATGTGG - Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1095684568 12:45018040-45018062 CTTTTGCACTGAATTGCCTGGGG - Intronic
1097907938 12:64939755-64939777 CATTATCACTGAAATGCAAGGGG + Intergenic
1098361735 12:69660928-69660950 CATTTGCAAGGGAAACCATGGGG - Intronic
1099880532 12:88461750-88461772 CTTTTACGCTGAAAAGGATGTGG - Intergenic
1102651812 12:114447709-114447731 CATTTGGAAGGAAAAGCAGGGGG - Intergenic
1103847208 12:123909763-123909785 CATGTGCACTGAACAGCACTGGG - Intronic
1108673283 13:52713244-52713266 CATTTGAAGTGAAAATCTTGTGG + Intronic
1111049905 13:82868423-82868445 CATATTCACTGAAATTCATGTGG + Intergenic
1111292877 13:86190008-86190030 GATTTCCACTGAAAAGCCTGTGG + Intergenic
1112492212 13:99877232-99877254 CATAGGCACTGAACACCATGGGG - Intronic
1113135016 13:107079602-107079624 CACTTCCCCTGAAAACCATGTGG - Intergenic
1113489843 13:110682754-110682776 CATGTGCGCTGAAAACCCTGGGG + Intronic
1113979605 13:114263146-114263168 TCTTTGCAGAGAAAAGCATGTGG + Intronic
1114459647 14:22878288-22878310 CATTTTCACTCAAATGCCTGGGG + Exonic
1116085684 14:40235195-40235217 CTTTTCCACTGAAAAGTCTGTGG + Intergenic
1117175507 14:53142225-53142247 CATTGGCAATAAAAACCATGTGG - Intronic
1118805756 14:69235402-69235424 CATTTCTCCTGAAAAGTATGAGG - Intronic
1120534043 14:85670673-85670695 CATCAGCACTGAAAACAATGAGG - Intergenic
1120601257 14:86513244-86513266 CTTTTGCTCTGACAATCATGTGG + Intergenic
1123951374 15:25280406-25280428 TATTTCCTCTGGAAAGCATGGGG - Intergenic
1124048593 15:26174575-26174597 CATTGCCTGTGAAAAGCATGGGG + Intergenic
1126935981 15:53708226-53708248 CATTAGCACTGAAATCCCTGGGG + Intronic
1127553420 15:60063770-60063792 CATTTGCAATGAAAAAAAAGCGG - Intergenic
1127597484 15:60500733-60500755 CATTTTGTCTGAAAGGCATGAGG + Intronic
1128932656 15:71719256-71719278 CATTTGGACTGAAAATCAGAAGG - Intronic
1130211238 15:81924723-81924745 CATTTGCACTGAACTGCTTGCGG + Intergenic
1131385893 15:92007083-92007105 CATTTCCACTGACACGCAGGAGG + Intronic
1131953386 15:97705640-97705662 CAAGCGCACTGAAAACCATGTGG + Intergenic
1133632734 16:7637120-7637142 CATTGGCATTGATAAGCATACGG - Intronic
1135967718 16:27049807-27049829 CATTTTTACAGAAAAGCATTGGG + Intergenic
1138410354 16:56834468-56834490 CATGCACACTGAAAACCATGGGG - Intronic
1138790557 16:59898765-59898787 AATTTACCCTGTAAAGCATGAGG + Intergenic
1139981473 16:70862288-70862310 CATTTGCAGTGAGAGGCAGGTGG + Intronic
1141303351 16:82838156-82838178 CATCTGCAATGAAAAGGGTGAGG - Intronic
1141337865 16:83174172-83174194 AATGTGTACTGAAAAGGATGAGG + Intronic
1142164400 16:88578131-88578153 TTTTTGGACTGAAAAGAATGAGG + Intronic
1143367169 17:6415829-6415851 CTTTTGCACTGAGCATCATGTGG - Intronic
1153530624 18:6042118-6042140 TATTTTCTCTGTAAAGCATGAGG - Intronic
1153793504 18:8601420-8601442 CGTTAGCATTGAAAAGAATGAGG + Intergenic
1155952133 18:31924797-31924819 TATTTGCATTTAAAAGCAGGTGG - Intronic
1156880795 18:42076695-42076717 CATTTGGGCTGAAAATTATGGGG - Intronic
1156944882 18:42816560-42816582 CATTTACACTTAAAAACCTGAGG - Intronic
1157466763 18:47954026-47954048 CATTTGCAGTGAATTCCATGTGG - Intergenic
1159059836 18:63503095-63503117 CATGTGCACTGAAATTTATGAGG - Intronic
1159539388 18:69756014-69756036 CATGTGCACTGGAAAAAATGGGG - Intronic
1160372441 18:78385239-78385261 CATTTGCACATAAATGTATGTGG + Intergenic
1162215597 19:9131315-9131337 CATCTGCAGTCAAAAGAATGAGG + Intergenic
1164003116 19:21123906-21123928 CATTTTCTCTGAAAAACATTTGG + Intronic
1164009599 19:21188698-21188720 CATTTTCTCTGAAAAACATTTGG + Exonic
1164685036 19:30160963-30160985 CATTTTTTCTGAAAAGCACGAGG - Intergenic
925520975 2:4745750-4745772 CATTAGCACTGAAAGGAAGGCGG - Intergenic
929808823 2:45170544-45170566 CATTTGCACTGATTAGCTAGCGG + Intergenic
932245618 2:70193783-70193805 CATTTTCAATGAAAAGAATTTGG + Intronic
932645301 2:73494226-73494248 CATTTCTACTGAAGAGAATGTGG - Intronic
934906026 2:98204481-98204503 AATTTGCACAGAAAAGGATTTGG - Intronic
936806556 2:116339640-116339662 CAGTTGCATTGAAAAGTATTGGG - Intergenic
940419271 2:153459526-153459548 CATATGCACTGAATTACATGGGG + Intergenic
941118280 2:161497329-161497351 CATTTTCACAGTAATGCATGAGG + Intronic
941147379 2:161866423-161866445 CATTAGCCCTGAAGAGAATGCGG - Intronic
941491841 2:166152236-166152258 CAGCTACACTGAATAGCATGTGG + Intergenic
942787960 2:179722256-179722278 CATTTGCATGGAAAAGCAAATGG + Intronic
945359964 2:208885490-208885512 CACATGCAATGAAAAGCAAGGGG + Intergenic
947239861 2:227982707-227982729 CATTTGCAATGAAAAAGATGTGG + Intronic
1170273181 20:14550918-14550940 CATTTGGAATGAAATTCATGAGG - Intronic
1170753001 20:19169201-19169223 CATTTGCTGTGAAAAGTATGAGG - Intergenic
1173444594 20:43106273-43106295 CATTTGCACTGAAAAGCATGGGG - Intronic
1174757206 20:53171374-53171396 TAATTGCAATTAAAAGCATGTGG - Intronic
1176853734 21:13945531-13945553 CATTTGCAATGTAAAAAATGGGG - Intergenic
1177064812 21:16417220-16417242 CATTTGCAAAGCAAAGGATGGGG - Intergenic
1177234377 21:18367949-18367971 TCTTTGAACTGAAAAGCAGGGGG + Intronic
1177622112 21:23610218-23610240 AATTTGTACTAAAAAGAATGGGG + Intergenic
1182419183 22:30240621-30240643 CCTTTCCACTGAAAAGCACATGG - Exonic
1182561763 22:31165217-31165239 CATTTGCACTAAAATTTATGAGG + Intronic
1184709577 22:46240707-46240729 CATTGGCATTGCCAAGCATGGGG + Exonic
949280514 3:2341533-2341555 AATTTGGACTGAAAGGCAGGAGG + Intronic
949680581 3:6509089-6509111 CATTTTTACTGAAACGCAAGTGG + Intergenic
950608972 3:14112702-14112724 CATATACACTGAAAAAAATGGGG - Exonic
952667505 3:35924180-35924202 CATTATCACAGAACAGCATGGGG - Intergenic
955066103 3:55534883-55534905 CATTTCCTCTCAAAACCATGGGG - Intronic
955590840 3:60533646-60533668 CAGATGAAATGAAAAGCATGGGG + Intronic
956595180 3:70959445-70959467 CAGGTGCACTGAAAAGTTTGGGG + Intronic
957568482 3:81915308-81915330 CATTTGCAGGGTAAAACATGGGG + Intergenic
957757208 3:84506043-84506065 CATTTGGTCTGACAACCATGTGG - Intergenic
958747944 3:98160433-98160455 CAGATGCATTGACAAGCATGTGG - Intergenic
959864660 3:111252531-111252553 CATTTGGACTCAGAGGCATGTGG + Intronic
962958771 3:140290868-140290890 AATTAGCCCTGAAAGGCATGAGG - Intronic
963393998 3:144708253-144708275 CATTTACTTTGAAAAGCAGGGGG + Intergenic
963894300 3:150669112-150669134 TTTTTCCACTGAAAAGCATACGG + Intronic
964533881 3:157698336-157698358 CATTATCACAGAACAGCATGAGG - Intergenic
967445095 3:189556351-189556373 CTATTGCAATTAAAAGCATGTGG + Intergenic
967619833 3:191619452-191619474 CAGTAACAATGAAAAGCATGAGG + Intergenic
970202421 4:13623441-13623463 CCTTTGCACTGATTAGCATCTGG - Intronic
970905570 4:21212337-21212359 CATTTGCACTCAAAAAGATTAGG + Intronic
970929905 4:21497425-21497447 CATTTGCACTGAAAAAACAGTGG - Intronic
971544236 4:27864846-27864868 AATTTGCACTATAAAGAATGTGG + Intergenic
975289909 4:72665539-72665561 CATTTGTTCTGAAAATCAAGGGG - Intergenic
977098285 4:92773936-92773958 CTTTTGCACTTAAAAGCATATGG - Intronic
977640420 4:99351856-99351878 CAGGTGCACAGAAATGCATGTGG - Intronic
978706009 4:111712453-111712475 CATTTGCAGAGAGAAGCACGCGG - Intergenic
978927755 4:114269751-114269773 CATTTGGGCTGAAAGACATGAGG - Intergenic
979180854 4:117725340-117725362 CACTTACACTCAAAAGCATGTGG - Intergenic
984096458 4:175441355-175441377 CTTTTACACTGAAAAGCAAAGGG - Intergenic
985287483 4:188351217-188351239 CACAAGCACTGAAAAGCTTGCGG - Intergenic
987428218 5:17797559-17797581 CATTTGTACAGAAAAGAATAGGG - Intergenic
987857260 5:23437079-23437101 CTTTTCAACTGAAATGCATGTGG - Intergenic
989121845 5:38012374-38012396 CACTTGCAATGGAGAGCATGAGG - Intergenic
990345058 5:54863641-54863663 GATTCTAACTGAAAAGCATGAGG - Intergenic
992237646 5:74728417-74728439 TCTTTGCACTGAATAGCCTGAGG + Intronic
992859435 5:80896051-80896073 CAATTTCTCTGAAAAGCAAGTGG + Intergenic
994983564 5:106906295-106906317 CATTTAAAGTGAAAAGCTTGAGG + Intergenic
994983845 5:106910024-106910046 CATTTGCACTGTAAATTATATGG + Intergenic
995963918 5:117880995-117881017 CATTTGCAATGTAAACAATGGGG + Intergenic
996029688 5:118691415-118691437 CATTTGATCTGAAAATCATGTGG + Intergenic
996921966 5:128778526-128778548 TCTTTGCTTTGAAAAGCATGAGG + Intronic
996946230 5:129072621-129072643 CTTTTGTACTGAAAATAATGTGG - Intergenic
997629072 5:135353043-135353065 CAGCTGCAAAGAAAAGCATGAGG + Exonic
999084561 5:148875698-148875720 CATTTCCACAGAAATGAATGAGG + Intergenic
1003788733 6:9517868-9517890 TATATGGATTGAAAAGCATGGGG - Intergenic
1004799784 6:19133819-19133841 CATCTCTACTGAAAAGCATTTGG + Intergenic
1005044650 6:21630021-21630043 TCTTTGCAATGAAAAACATGTGG - Intergenic
1005114740 6:22323186-22323208 AATTTGCATTCCAAAGCATGAGG - Intergenic
1007770689 6:44189641-44189663 CATTTTTACTGCAAAGAATGAGG + Intergenic
1015830762 6:137366207-137366229 CATTTGCACAGAACAGCATCTGG - Intergenic
1016527857 6:145022965-145022987 AATTTCCAGTTAAAAGCATGTGG - Intergenic
1018624901 6:165767881-165767903 CATTCTCACTGCAATGCATGAGG + Intronic
1018816516 6:167336719-167336741 AAATTGCACTGAAGAGCTTGTGG + Intronic
1022959185 7:35410020-35410042 CTCCTGCACTGAACAGCATGGGG + Intergenic
1024641223 7:51330214-51330236 CATTTTCTCTGAAAAACAGGAGG - Intergenic
1024946406 7:54812044-54812066 TGTTTACACTGAGAAGCATGTGG - Intergenic
1025760632 7:64387147-64387169 CATTTCCCCTAAAAATCATGTGG - Intergenic
1026324402 7:69296282-69296304 CATTTGGACTTCAAAGCAAGTGG - Intergenic
1026713092 7:72760640-72760662 CATGTGAACTGAAAGGCATTTGG - Intronic
1027511317 7:79084585-79084607 CATGTGCCCTGCAAAGAATGTGG + Intronic
1028359050 7:89945787-89945809 CAGTTCCACTGAATAGGATGGGG + Intergenic
1029064214 7:97832346-97832368 CAGTTGCACTGGCAACCATGAGG + Intergenic
1029886601 7:103878995-103879017 CCTTTGCATTGATAAGCATTAGG - Intronic
1032325139 7:130921000-130921022 CCTTTTCTCTGAAAAGCATAAGG + Intergenic
1032500008 7:132393104-132393126 CATTTCCAGCGAAAAGGATGAGG - Intronic
1032565359 7:132936368-132936390 CATTTGAAATCAAAAGCTTGCGG + Intronic
1032708506 7:134442656-134442678 CATTTGCAAGGAAAAAAATGAGG + Exonic
1033501914 7:141959716-141959738 TTTTTGCACAGAAAAGCTTGGGG + Intronic
1034094742 7:148396635-148396657 ACTTTTCTCTGAAAAGCATGTGG - Intronic
1034536965 7:151731422-151731444 CATTTCCACTGGAAAGCCTGTGG - Intronic
1036657452 8:10686535-10686557 TTCTTGTACTGAAAAGCATGTGG - Intronic
1037159268 8:15748180-15748202 CATTTTCATTGAGAAGAATGTGG + Intronic
1038202037 8:25421841-25421863 CATTTCTACTGAATGGCATGGGG + Intronic
1039123932 8:34179436-34179458 CATTTGCTTTGAAAACCATAAGG + Intergenic
1040412191 8:47165500-47165522 CATTTCCACTGATCAGCAGGAGG - Intergenic
1040907523 8:52484096-52484118 CATTTGCAGAGAAAGGCATGAGG - Intergenic
1041248757 8:55914370-55914392 CATTTGCACCCTAAAGTATGGGG - Intronic
1044997775 8:97853585-97853607 CATATGCACTGGAAATGATGAGG + Intergenic
1045191352 8:99887801-99887823 AATTTGCAAAGAAAAGAATGGGG + Intronic
1045683029 8:104682712-104682734 CTTTTTCACTTAAAAGTATGTGG - Intronic
1045703315 8:104892337-104892359 CACCAGCACTGAAAACCATGTGG + Intronic
1046449118 8:114364560-114364582 GCTTTCCACTGAAAAGCCTGTGG - Intergenic
1047055376 8:121158477-121158499 GATTTCCACTGAACAGCATTTGG - Intergenic
1048247425 8:132822526-132822548 CATTTACAATGCAAACCATGAGG - Intronic
1048721403 8:137329838-137329860 CTTCTGTTCTGAAAAGCATGTGG + Intergenic
1050646537 9:7725629-7725651 CAGTTCCACTGACAAGCATGGGG + Intergenic
1051189836 9:14499708-14499730 GATTTGCACTCAAAAGATTGAGG - Intergenic
1052665556 9:31490840-31490862 TATTTGGAGTGAAATGCATGTGG + Intergenic
1053346764 9:37383853-37383875 TATTTACATTGAAAAACATGAGG + Intergenic
1056771925 9:89483941-89483963 CGTTTGAACTGAGATGCATGTGG - Intronic
1057440784 9:95081618-95081640 CATTTGCACAGCAGAGCAAGAGG + Intronic
1057931372 9:99196357-99196379 CATCTGCACTCAAAGGCAGGAGG + Intergenic
1058645267 9:107126323-107126345 CAGAAGCAATGAAAAGCATGCGG + Intergenic
1059623926 9:116040407-116040429 TTTATGCAGTGAAAAGCATGGGG + Intergenic
1061740472 9:132700726-132700748 CATGTGAACTAAAAAGCATTTGG - Intergenic
1185885883 X:3782403-3782425 CATTTGCATTTCAAAGCAAGTGG + Intergenic
1185970107 X:4653421-4653443 CATTGTCACTGAGAAGAATGAGG + Intergenic
1187988437 X:24841522-24841544 CATTTGAACTCAAAAGCACATGG - Intronic
1188425111 X:30037203-30037225 CAGAGGCACTGAAAAGCATAGGG - Intergenic
1189162035 X:38819310-38819332 CATTTACACTGAAAGATATGAGG - Intergenic
1189676524 X:43466308-43466330 CATTTGCACTGAATTCCTTGTGG + Intergenic
1192346151 X:70308248-70308270 CATATGCACAGAAAAACATCTGG - Intronic
1192551744 X:72060076-72060098 CATTTGACCTCAGAAGCATGAGG + Intergenic
1193392959 X:80950389-80950411 GATTTGTACTGAACAGAATGAGG + Intergenic
1193492260 X:82164433-82164455 CCTTTGCACAGAAAGACATGGGG + Intergenic
1193817602 X:86122566-86122588 CAGATGCACAGAACAGCATGTGG - Intergenic
1194128450 X:90049133-90049155 CATTTGCACTTACAAGTATTAGG + Intergenic
1194130373 X:90074092-90074114 CATGTGCACTGACAAGAAAGAGG + Intergenic
1194188425 X:90804868-90804890 TATTTGCTTTGAAATGCATGTGG - Intergenic
1194647306 X:96473139-96473161 CATCTGCACTGCAAAGCTTCAGG + Intergenic
1194829423 X:98602763-98602785 CTTTTGAACTGAACAGCATTAGG + Intergenic
1195436482 X:104849801-104849823 CATGTGAACTAAAAAGCATTTGG + Intronic
1197233940 X:124037280-124037302 ATTTTGCATTGAAAAGAATGTGG - Intronic
1197586751 X:128357494-128357516 TATTTGCAATAAAAACCATGTGG + Intergenic
1197968250 X:132088193-132088215 AATTTGCACTGAAAAGAAGGTGG + Intronic
1198215399 X:134550140-134550162 GATCTGCACTCAAACGCATGGGG - Intergenic
1198864248 X:141104559-141104581 CATTTGGATTAAAAACCATGGGG + Intergenic
1198898441 X:141482857-141482879 CATTTGGATTAAAAACCATGGGG - Intergenic
1199893744 X:152113340-152113362 GATTTGCATGGAAAAGCATCTGG - Intergenic
1200535015 Y:4386768-4386790 TATTTGCTTTGAAATGCATGTGG - Intergenic
1201429003 Y:13886918-13886940 CATTTGATCTGAAAAGGTTGAGG - Intergenic