ID: 1173446596

View in Genome Browser
Species Human (GRCh38)
Location 20:43124478-43124500
Sequence TGGGGTCCAAATGCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173446596_1173446598 -5 Left 1173446596 20:43124478-43124500 CCTGGCTGTGCATTTGGACCCCA 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1173446598 20:43124496-43124518 CCCCAGTTCACCCATCAGTCAGG 0: 1
1: 0
2: 0
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173446596 Original CRISPR TGGGGTCCAAATGCACAGCC AGG (reversed) Intronic
900753517 1:4416674-4416696 TGGGCTCCAAATGCACCACAGGG - Intergenic
900907541 1:5571451-5571473 TTAGGTCTAAAGGCACAGCCGGG - Intergenic
901478041 1:9504446-9504468 AGGGGTGCAAGTGGACAGCCTGG + Intergenic
901664462 1:10818607-10818629 TGGTGGCCAGAGGCACAGCCTGG - Intergenic
902189597 1:14752907-14752929 AGTGGTCCAAATGCACAGCTGGG - Intronic
903264720 1:22150902-22150924 TGGGATCCCCCTGCACAGCCTGG + Intergenic
903845674 1:26278664-26278686 TGGGCTCCCAATGCACAGGGTGG - Exonic
904710595 1:32427016-32427038 TGGGAGCCAGAGGCACAGCCGGG + Intergenic
905166656 1:36087107-36087129 AGGGGGCCACATGCACAGCAGGG - Intronic
909090891 1:71224167-71224189 TGGGGAACAAATGCACAGATGGG - Intergenic
912023522 1:105138153-105138175 GGGGGCCCAAATGCACAGCTTGG - Intergenic
913597100 1:120388902-120388924 TGGGGTCAGAAAGCACACCCTGG - Intergenic
916798740 1:168193564-168193586 TTGGATACAAATGCACACCCAGG - Intronic
919044506 1:192434071-192434093 TGGAGTCCTAATGTACAGCATGG - Intergenic
921394275 1:214651856-214651878 TTGTGTCCAAAAGCAAAGCCTGG - Exonic
922169622 1:223143522-223143544 AAGTGTCCAAAAGCACAGCCAGG + Intergenic
922709588 1:227816567-227816589 TGGTCCTCAAATGCACAGCCTGG + Intronic
922891838 1:229067704-229067726 TGTTGTCCTGATGCACAGCCTGG - Intergenic
923147376 1:231207672-231207694 TGGTGTCAAAAGGCCCAGCCAGG + Intronic
924739954 1:246789200-246789222 TGGGCTGCAAATGCGCGGCCCGG - Intergenic
1063661773 10:8039221-8039243 TTGGGTCCAAAAGAGCAGCCTGG - Intergenic
1065094309 10:22265612-22265634 TGGAGCCCAAATGCAATGCCTGG - Intergenic
1065661004 10:28004179-28004201 TGGAGACCAACTGCAGAGCCAGG - Intergenic
1066405990 10:35118962-35118984 TGGGGTCCCCAGGCACAGGCTGG + Intergenic
1067336604 10:45371329-45371351 TGGGGATCAAATGTACAGCATGG + Intergenic
1068701761 10:60027806-60027828 TGGGTTGCAAATTCACAGTCAGG + Exonic
1069084996 10:64128662-64128684 TGTGGTCCAGATGCAAAGTCAGG - Intergenic
1072627115 10:97119642-97119664 TGGGGGTCAGATGCAAAGCCAGG - Intronic
1075065350 10:119285569-119285591 TTGGGGCCAAAGGCACAGCAGGG + Intronic
1077637254 11:3851745-3851767 TGGGAGCCAAAGCCACAGCCTGG - Intergenic
1080233689 11:30045657-30045679 AGGGACCCAAATGCACAGCTTGG + Intergenic
1090058805 11:123446104-123446126 TGAGGTCCAAGTACAAAGCCTGG - Intergenic
1091747583 12:3002681-3002703 TAGGTGCCAAATGCACAGCACGG + Intronic
1092543665 12:9435603-9435625 CGAGGTCCACATGCGCAGCCTGG + Intergenic
1094669721 12:32557726-32557748 TGGGGAACAAATCCATAGCCAGG - Intronic
1099115588 12:78620449-78620471 TGGGGTTCTAATGCACAGTAGGG - Intergenic
1100458701 12:94777322-94777344 TGGGATCCAAACCCACAGTCTGG + Intergenic
1101361714 12:104033563-104033585 TGGAGACCTAATGCACAGCATGG + Intronic
1103680167 12:122687294-122687316 TGAGGGCCTAATGAACAGCCTGG + Intergenic
1104419217 12:128621349-128621371 TGGAGTCCAAATGCAATGACTGG + Intronic
1105873801 13:24535790-24535812 TGAGGTCCAGATGCCCAGGCAGG + Intergenic
1111955860 13:94757860-94757882 TGGGGTCCAGATGCCCTGCTGGG + Intergenic
1112416729 13:99209081-99209103 TGGGACCCACATGCACAGCCAGG - Intronic
1114209077 14:20600569-20600591 GGGGGCCCAAATGCACAGCTTGG + Intronic
1115452496 14:33564395-33564417 TGGAGTCCATATTCACAGCAAGG + Intronic
1115646262 14:35370147-35370169 AGGTGTCCAGATGTACAGCCCGG + Intergenic
1117189802 14:53278545-53278567 GGGGGCCCAAATTCACAGCTTGG - Intergenic
1118614547 14:67566325-67566347 TGGAGTCCAAATGCAGAGGTTGG + Intronic
1119321391 14:73733163-73733185 TGGAGTCCCAATCCAAAGCCTGG - Intronic
1119756593 14:77124318-77124340 GGTGCTCCAAGTGCACAGCCAGG + Intronic
1121625638 14:95383835-95383857 TGGGGTCCTGAGGCACAGCAAGG + Intergenic
1125758843 15:42083740-42083762 TGCTGTCCAGATGCACATCCAGG + Exonic
1126851675 15:52801050-52801072 TAGGGTCCATGTGCGCAGCCAGG + Intergenic
1126953732 15:53911185-53911207 GGGGGCCCAAGTGCACAGCTTGG + Intergenic
1128803133 15:70509843-70509865 TGGGGTACAACTGCTCACCCTGG - Intergenic
1130771797 15:86931455-86931477 TGGGGTCCACTTGCCCAGCATGG - Intronic
1131132915 15:89911716-89911738 TGGGGACCTAATGTACAGCATGG - Intronic
1132469873 16:96513-96535 TGAAGTCCAAAGGCACAGCTGGG + Intronic
1132783553 16:1641929-1641951 GGGGTTCCCAGTGCACAGCCTGG + Intronic
1136280265 16:29204419-29204441 TGGGGATCTAGTGCACAGCCTGG - Intergenic
1137446551 16:48535801-48535823 GGGGATCCCAGTGCACAGCCAGG + Intergenic
1138498720 16:57425211-57425233 TGGGGTCCAAGGGCACAGGCAGG - Intergenic
1138553757 16:57760631-57760653 GGAGGTCCATTTGCACAGCCTGG + Intronic
1138798455 16:59997929-59997951 TGGAGTCCAAGTGCTCATCCAGG + Intergenic
1140268960 16:73445791-73445813 AGGTGTCCAAATGCACAGCAGGG + Intergenic
1141048772 16:80742155-80742177 TGGGGTCAGAATGCAAACCCAGG + Intronic
1142084626 16:88170361-88170383 TGGGGATCTAGTGCACAGCCTGG - Intergenic
1142292209 16:89198383-89198405 TGGGGACCATATGCCCACCCCGG + Intronic
1143103845 17:4518815-4518837 TGGGTTCTGAAGGCACAGCCGGG + Intronic
1143208692 17:5166606-5166628 TTGTGTCCCAAAGCACAGCCCGG - Intronic
1143696987 17:8628886-8628908 TGGAGCCCAAATGAAAAGCCAGG + Intronic
1144505021 17:15822189-15822211 TGGGTTCCATCTGCACAGCGAGG - Intergenic
1145901297 17:28491978-28492000 GGGGGTCCAAGTGCACAGAGGGG - Intronic
1147892657 17:43728288-43728310 TGTGGTCCAAATGCTCAGGAAGG - Intergenic
1152314714 17:79573451-79573473 TGGGCTCCGAGTGCTCAGCCTGG - Intergenic
1152475302 17:80513974-80513996 TGGGGAGCCACTGCACAGCCTGG - Intergenic
1159274674 18:66201401-66201423 TGGGGTAAAAATGAAGAGCCTGG - Intergenic
1160111494 18:76036533-76036555 TTAGGTCCAGATACACAGCCTGG + Intergenic
1160784007 19:891437-891459 TGGGGGCCAAGGGCACAGCCGGG + Intronic
1163168374 19:15513125-15513147 TGTGGTCCATATGGAAAGCCTGG - Intronic
1163200038 19:15760452-15760474 TGGGGCCCAAATGCGGATCCTGG - Intergenic
1163633272 19:18427582-18427604 TCTGGTCCACATGCCCAGCCGGG + Intronic
1163691123 19:18739043-18739065 TGGGGTCCACTCTCACAGCCAGG + Intronic
1164590430 19:29503919-29503941 TGGGGACCCAATGCCCAGACAGG + Intergenic
1165362690 19:35346455-35346477 GGGGGTCCAAAAGCCCAGGCGGG - Intronic
1165598845 19:37035607-37035629 TGGGGCCCACATGCAAATCCAGG - Intronic
926541089 2:14182523-14182545 AGGGGTCCCAAGGCAGAGCCAGG + Intergenic
927736812 2:25531439-25531461 TGTGATCCACATGCACATCCAGG + Intronic
928435593 2:31252683-31252705 TGGGGTCCAAAGACAAAGGCAGG - Intronic
928611873 2:32999295-32999317 TCGGGTTAAAATGCACATCCCGG - Intronic
929913484 2:46114089-46114111 TCGGGTCCAAAGGCCCAGCCTGG - Intronic
930033179 2:47070429-47070451 TGTAGCCCAAATGCAGAGCCAGG - Intronic
932627566 2:73310300-73310322 TGGAGACCTAATGCACAGCATGG - Intergenic
934212168 2:89990449-89990471 TCAGACCCAAATGCACAGCCAGG + Intergenic
934573320 2:95385273-95385295 TGGGGCCCCAAAGCCCAGCCCGG + Exonic
935127228 2:100235300-100235322 TGAGTTCTACATGCACAGCCAGG - Intergenic
935391526 2:102558247-102558269 TGGCCTCCCAATGCCCAGCCTGG - Intergenic
938314792 2:130318065-130318087 TGGGGCCCAAATGCCTATCCAGG - Intergenic
941806639 2:169716854-169716876 GGGAGCCCAAATGCACAGCTTGG - Intronic
942328262 2:174794016-174794038 GGTGGTCCTAATGGACAGCCAGG + Intergenic
946414327 2:219532026-219532048 TCGGGTGCAGATCCACAGCCAGG + Exonic
948003589 2:234589347-234589369 TGGAGACCTAATGCACAGCCCGG - Intergenic
948195159 2:236090165-236090187 TGGGCTCCAGCTGCACAGGCTGG + Intronic
948920420 2:241063718-241063740 TGGGCCCCACATGCAGAGCCTGG + Intronic
1171089245 20:22268468-22268490 TAGGGACCCAATGCACATCCTGG - Intergenic
1171202485 20:23253452-23253474 TGGGGACCTAATGCACAGCATGG - Intergenic
1171359428 20:24576708-24576730 TGGGGAGCAAGTGCCCAGCCTGG - Intronic
1173446596 20:43124478-43124500 TGGGGTCCAAATGCACAGCCAGG - Intronic
1174151317 20:48488528-48488550 AGAGGGCCAAATGCACAGCCAGG + Intergenic
1174691977 20:52515670-52515692 TGGAGACCAAATGAACAGGCAGG - Intergenic
1175185285 20:57175818-57175840 TGTGGGCCACAGGCACAGCCTGG - Intronic
1176256144 20:64154230-64154252 TGGGGTCCAGGAGCAGAGCCGGG - Intronic
1176256154 20:64154263-64154285 TGGGGTCCAGGAGCAGAGCCGGG - Intronic
1176256164 20:64154296-64154318 TGGGGTCCAGGAGCAGAGCCAGG - Intronic
1176295089 21:5067473-5067495 TGGAGCCCAGATGCACAGCCTGG + Intergenic
1176308054 21:5134692-5134714 TGGGGACCATGTGCACCGCCAGG + Intronic
1177652031 21:23969400-23969422 GGGGGCTCAAATGCACAGCTTGG - Intergenic
1179849006 21:44127340-44127362 TGGGGACCATGTGCACCGCCAGG - Intronic
1179861960 21:44194655-44194677 TGGAGCCCAGATGCACAGCCTGG - Intergenic
1179883240 21:44302088-44302110 GGGGTTCCAACTGCTCAGCCTGG + Intronic
1180249075 21:46567577-46567599 TGGGGTCCAGCTGGTCAGCCAGG - Exonic
1183332937 22:37231119-37231141 TGAGTTCAAACTGCACAGCCTGG + Intronic
1183950230 22:41348625-41348647 TGGGCTCCATATGCACACCATGG - Intronic
1184279794 22:43430444-43430466 TGGGGTCCAGGGGCACAGCAAGG + Intronic
1184389543 22:44195419-44195441 TGGGCACCAAATACACAGACTGG - Intronic
949411109 3:3765664-3765686 TGGTGACCAAAGGCTCAGCCAGG + Intronic
949515597 3:4804288-4804310 TGGGGTCCTAAAGCCCAGCTGGG + Intronic
950505150 3:13389965-13389987 TGGTGTCCAAAGTCAAAGCCCGG + Intronic
951922306 3:27869957-27869979 TGGGGTCCAAAGGTACTGCCTGG + Intergenic
952266271 3:31789567-31789589 GGGGGACCAAGTGCAGAGCCGGG + Intronic
953461517 3:43085125-43085147 TGGAGGCCAACTGCAGAGCCTGG - Intronic
954200078 3:49018735-49018757 CGTGGTCCACCTGCACAGCCGGG + Intronic
956204178 3:66738774-66738796 TGGGGCCCAGATGCACCGCAGGG - Intergenic
959162143 3:102736370-102736392 GGGGGCCCAAATGCACAGCTTGG + Intergenic
960534639 3:118802672-118802694 GGGAGCCCAAATGCACAGCTTGG - Intergenic
960675732 3:120193017-120193039 GGAGGTCCCAATGCACAGCATGG + Exonic
961413599 3:126741595-126741617 GGTGATCCAGATGCACAGCCAGG - Intronic
961446018 3:126982252-126982274 TGGGGGCCAAGTCCCCAGCCGGG + Intergenic
962249900 3:133829459-133829481 CTGGTTCCAAATGCACAGCCAGG + Intronic
967162182 3:186748660-186748682 TTGCTTTCAAATGCACAGCCAGG + Intergenic
968519250 4:1028318-1028340 TGGGGTCCCCCTGCCCAGCCTGG - Intergenic
969221133 4:5759432-5759454 TGGGGTTCAAATTCCCAGCCGGG + Intronic
970661582 4:18291611-18291633 GGGGGAGCAAATGCACAGCAGGG + Intergenic
972012226 4:34199196-34199218 TGAGGATCAAATGCACAGCATGG - Intergenic
972802322 4:42490057-42490079 TGGGGTTCAAACACTCAGCCAGG + Intronic
972803323 4:42500658-42500680 TGTCGTCCAAAAGCAAAGCCAGG - Intronic
985852701 5:2400330-2400352 TGGGGTCCAGCTGCTCAGCTGGG + Intergenic
985961007 5:3303156-3303178 TGGGGTTCACAGACACAGCCGGG - Intergenic
986738237 5:10683060-10683082 TGGGGTCCACATGGGCAGGCTGG + Intronic
990610488 5:57452082-57452104 TGGGGATAAAATGCACAGACAGG + Intergenic
991480789 5:67077021-67077043 TGTGACTCAAATGCACAGCCAGG - Intronic
994330741 5:98502927-98502949 TGGAGTCCTAATGTACAGCATGG - Intergenic
994650036 5:102515848-102515870 TGGAGTCAAGATACACAGCCAGG - Intergenic
994734113 5:103531205-103531227 AGGTGTCCAAAGACACAGCCTGG - Intergenic
997590472 5:135069079-135069101 TGAGGTCCCAATGCCCAGCATGG - Intronic
1000450702 5:161383185-161383207 TGGGGACCTAATGTACAGCATGG - Intronic
1004198697 6:13528434-13528456 TGAGGCTCTAATGCACAGCCTGG + Intergenic
1006520250 6:34567145-34567167 TGGGGTCCACACGCAATGCCAGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1007128092 6:39444596-39444618 TGGGGCTCTAATGCACAGCATGG - Intronic
1007740406 6:44006287-44006309 TTGGGTCCAAAGTCACTGCCTGG + Intergenic
1012753812 6:103198117-103198139 TGGGGATCAAATGTACAGCATGG + Intergenic
1019415222 7:923946-923968 TGGGGCCCAAACGTCCAGCCTGG - Intronic
1019634470 7:2068151-2068173 TGGGGTGCACCTGCAAAGCCAGG + Intronic
1026592760 7:71711053-71711075 TTGGGTCCACAAGCCCAGCCCGG - Intronic
1034318317 7:150155220-150155242 TACCGCCCAAATGCACAGCCCGG - Intergenic
1034774435 7:153812012-153812034 TACCGCCCAAATGCACAGCCCGG + Intergenic
1034954810 7:155327763-155327785 TGGGCTCCCTGTGCACAGCCTGG + Intergenic
1035126738 7:156613357-156613379 TTGGGGCAAAATGAACAGCCAGG - Intergenic
1035328647 7:158082332-158082354 TGGGTGCAAAATCCACAGCCTGG - Intronic
1036651151 8:10644818-10644840 TGGGGCTCTAATGTACAGCCAGG + Intronic
1036710774 8:11077248-11077270 TGGGGTCCAAAGCCTCAGCGTGG + Intronic
1037298792 8:17430104-17430126 TTGGTTCCAAATGCCCACCCAGG + Intergenic
1039431243 8:37526778-37526800 TCGAGTGCAAATGCACAGCGTGG + Intergenic
1039581552 8:38671002-38671024 AGGGGTCCAAAATCCCAGCCTGG + Intergenic
1040514534 8:48124175-48124197 TGGGGACCAAACCCACAGACCGG - Intergenic
1042839245 8:73107371-73107393 TGGGGGCTAAATGCACCACCAGG + Intronic
1049995537 9:1030726-1030748 TGGGGATCTAATGTACAGCCTGG - Intergenic
1058771416 9:108236433-108236455 TGGGGCCCTAATGTACAGCATGG + Intergenic
1061874042 9:133535146-133535168 TGGGGTCCAAAAGCAGCGGCTGG - Intronic
1062366186 9:136210262-136210284 TTGGGTCTCAATGCACAGGCTGG + Intronic
1187135263 X:16541970-16541992 TGGGGTTCAGAGGGACAGCCAGG - Intergenic
1187743326 X:22380387-22380409 TGGAGACCTAATGTACAGCCTGG - Intergenic
1194427492 X:93757512-93757534 TGGGCTCCTAATGCACAGGGTGG + Intergenic
1195685247 X:107579142-107579164 CAGGGTCCAAAGCCACAGCCTGG + Intronic
1196137773 X:112228609-112228631 TGGGGATCTAATGCACAGCATGG - Intergenic
1197448160 X:126578452-126578474 TGGTGTTCTATTGCACAGCCGGG + Intergenic
1199552399 X:149074235-149074257 GGGGGCCCAAATACACAGCTTGG + Intergenic