ID: 1173447765

View in Genome Browser
Species Human (GRCh38)
Location 20:43135478-43135500
Sequence TCACATTGATGGTCTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173447765 Original CRISPR TCACATTGATGGTCTCCTGG TGG Intronic
900908869 1:5580100-5580122 TCACCTTGATGGCCTCCTTCAGG + Intergenic
901177753 1:7317092-7317114 TCACAGTGTTGGTCTCCAGAGGG - Intronic
902629505 1:17696373-17696395 ACAAGCTGATGGTCTCCTGGGGG + Intronic
907228887 1:52976331-52976353 TCACATGGTTGGTCTTTTGGTGG + Intronic
908479581 1:64525062-64525084 TCACAGAGATGGTCCACTGGTGG - Intronic
911035112 1:93534747-93534769 TCAAATGGAAAGTCTCCTGGAGG - Exonic
915915434 1:159937785-159937807 CCAGATTGAGGGTCTCCGGGTGG - Exonic
918279118 1:182985785-182985807 TCACATTGTTGCTCTACTGCAGG + Intergenic
919896720 1:202013607-202013629 TCACATTGAGGGTGTCCCAGAGG - Intronic
1069522723 10:69137557-69137579 TCAGAGTGATGGTCTCCTCCTGG - Intronic
1070046293 10:72840149-72840171 TCACACTGATGTACTGCTGGTGG - Intronic
1071514094 10:86285544-86285566 GCACAGTGCTGGTCTCTTGGAGG - Intronic
1071990875 10:91099771-91099793 TTACATTGATGCCCTACTGGAGG + Intergenic
1072785320 10:98275523-98275545 CCACAATGATGGGCTCCTTGGGG - Intergenic
1073547484 10:104363265-104363287 ACACAGTGCTGGGCTCCTGGAGG - Intronic
1074336621 10:112582831-112582853 GCACAGTGGTGGTCTCCAGGTGG - Intronic
1075126911 10:119707861-119707883 TCACATTGACAGATTCCTGGTGG - Intergenic
1077738960 11:4823594-4823616 TCACATCCATGGCCTCATGGGGG - Intronic
1080213774 11:29817776-29817798 TGGCATTGATGGTTTCCTGCTGG + Intergenic
1085022001 11:73215842-73215864 GCACAGTAATGGTCCCCTGGAGG - Intergenic
1085753621 11:79185559-79185581 CCACATTGATTGTCTCCTCCTGG - Intronic
1086349940 11:85935153-85935175 TCACCTTGATGGTCTCCATGGGG - Intergenic
1089009624 11:115121918-115121940 CCACTTTGATGGTGGCCTGGAGG + Intergenic
1091779428 12:3204607-3204629 TCACCTTGCTGCCCTCCTGGAGG - Intronic
1092887788 12:12940603-12940625 TCAAAATGGTGGTCTTCTGGTGG + Intergenic
1095294898 12:40516491-40516513 TGTCATAGATGGACTCCTGGAGG - Intronic
1096575897 12:52552750-52552772 TCTCATTGACGGTAACCTGGTGG + Exonic
1101475708 12:105045570-105045592 TCACATTGGTTGTCTCTGGGAGG + Intronic
1101580587 12:106038044-106038066 TCACACTGAGGGTGTCCTAGGGG + Intergenic
1105329554 13:19402886-19402908 TCACACTGTGGGTCTTCTGGAGG - Intergenic
1105862283 13:24426146-24426168 TCACATTGTGGGTCTTCTGGAGG + Intronic
1106010108 13:25812365-25812387 TCTCTTTGATGCTCTCCAGGAGG + Intronic
1107100306 13:36583151-36583173 TCACCTTCATGGTCTCCAGAGGG - Intergenic
1107956602 13:45519607-45519629 TCACATTGGTGGTCTCTTCCTGG + Intronic
1109395428 13:61752214-61752236 TAATATTGATGATCACCTGGAGG - Intergenic
1109531934 13:63661193-63661215 TCAAATTGATGTTCTCCTATAGG + Intergenic
1112814448 13:103255275-103255297 TCATAATAATGGTCTGCTGGTGG - Intergenic
1113096704 13:106673069-106673091 TCACATTGATGGAGGCTTGGGGG - Intergenic
1114670813 14:24410011-24410033 TCAGATGGAGGGGCTCCTGGGGG + Exonic
1115687076 14:35807696-35807718 TAATATTGGTGGTATCCTGGTGG + Intronic
1119322446 14:73739885-73739907 TCACTCTGATGGACTGCTGGGGG + Exonic
1119702328 14:76763314-76763336 TCACATACATTGTCTCCAGGAGG + Intronic
1119805985 14:77482652-77482674 CCACCTTGATGGTCACCTGCAGG + Exonic
1123059545 14:105588278-105588300 TCACACTGAGTGGCTCCTGGGGG + Intergenic
1123083884 14:105708548-105708570 TCACACTGAGTGGCTCCTGGGGG + Intergenic
1125457417 15:39874308-39874330 TCACATGGATGATCTGCTGATGG + Intronic
1126745460 15:51821891-51821913 TCACATTGATTGATTTCTGGTGG - Intergenic
1128815686 15:70606437-70606459 TCAGATTGAAGGTTTCCTGCAGG - Intergenic
1130109087 15:80950135-80950157 GCACATCTAGGGTCTCCTGGAGG - Exonic
1130406020 15:83602692-83602714 TAACAATGATGGACTCCTGCTGG + Intronic
1133274816 16:4631345-4631367 TCACATTCATGGTTAACTGGTGG - Intronic
1134080572 16:11322361-11322383 TCACATTTTTGGCCTCCTGGAGG - Intronic
1135423571 16:22321100-22321122 TGAAACTGATGGTCTCGTGGAGG - Intronic
1135739076 16:24957847-24957869 TCACATTCATGGTCAGTTGGTGG - Intronic
1144373594 17:14617197-14617219 TCACATTAATGGTCACCTTCTGG + Intergenic
1144761307 17:17709114-17709136 TCATAATGATGGTCCCCGGGTGG - Intronic
1148470279 17:47888949-47888971 TCCCATTGCTAGTCTCCTGAGGG - Intergenic
1150416133 17:64990253-64990275 TGACATTGAGTGTCACCTGGGGG + Intergenic
1150795543 17:68233917-68233939 TGACATTGAGTGTCACCTGGGGG - Intergenic
1156087668 18:33426376-33426398 TCAAATTGATGGATTCCTTGAGG - Intronic
1157140630 18:45102520-45102542 TAACATTGATTGCCTCCAGGAGG - Intergenic
1164527115 19:29020617-29020639 TCCCATTCAGGGCCTCCTGGAGG + Intergenic
1166794254 19:45416820-45416842 GCACATTGATCCTCGCCTGGAGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
926384015 2:12318052-12318074 CCAGATTGATGGCCTCCTGGCGG + Intergenic
926482361 2:13415029-13415051 AAGCATTGATGGTGTCCTGGGGG + Intergenic
926637176 2:15194324-15194346 TCACATTAATGTTCTCCTATAGG - Intronic
939277480 2:140017832-140017854 TTACATTAATAGTTTCCTGGGGG + Intergenic
941295954 2:163737642-163737664 TCAGCTTGATGGGCTCCTGGTGG - Intergenic
944509066 2:200446456-200446478 CCAAATCAATGGTCTCCTGGGGG - Intronic
945611860 2:212013467-212013489 TCACATTAATAGTTTCCTGTGGG - Intronic
1169285793 20:4306098-4306120 TCTCATTGCTGGTCTCCTTGAGG - Intergenic
1169404607 20:5313443-5313465 TCAGATTGGTGGTTGCCTGGTGG + Intronic
1169910678 20:10645241-10645263 TCACACTGACTGTCACCTGGAGG + Exonic
1173105628 20:40130932-40130954 TCACATCGATGGTGACCTGAGGG + Intergenic
1173447765 20:43135478-43135500 TCACATTGATGGTCTCCTGGTGG + Intronic
1174519133 20:51116221-51116243 TCACATTGGTGGTATGCTGGAGG + Intergenic
1175219682 20:57409700-57409722 CCACATTCAGGGTCTTCTGGTGG - Intergenic
1180206765 21:46265645-46265667 CCACGTAGCTGGTCTCCTGGAGG - Intronic
1180565363 22:16659170-16659192 TCACATTGTGGGTCTTCTGGAGG + Intergenic
1180876554 22:19177723-19177745 CCACCTTGATGGTCTCCATGGGG + Exonic
1182403695 22:30105345-30105367 TCACATTCTTGGTCACCTTGTGG + Intronic
1182947801 22:34340986-34341008 TCACTTTGATGAACTGCTGGAGG - Intergenic
949278875 3:2322934-2322956 TCACATTGATGGAATACTGGAGG + Intronic
950923169 3:16715721-16715743 CCACTTTGCTTGTCTCCTGGGGG + Intergenic
950987586 3:17391628-17391650 TCTCACTGATGCTCTCCTGAAGG - Intronic
951844112 3:27067046-27067068 TCAGATTCACAGTCTCCTGGAGG - Intergenic
953659632 3:44882751-44882773 TCACATTCATAGGCTCCAGGTGG + Intronic
954682817 3:52355118-52355140 TGTCACTGATGGTCTCCGGGTGG + Intronic
955916132 3:63910632-63910654 TCTCATTGATAGTCTTATGGAGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
972637461 4:40896891-40896913 TCACTAAGATGCTCTCCTGGTGG - Intronic
974199919 4:58623917-58623939 CCACTTTGCTTGTCTCCTGGGGG - Intergenic
974580935 4:63800395-63800417 TCACACTTCTGGTCTCATGGAGG + Intergenic
975594575 4:76037001-76037023 TCACATTCTTGGTCACCTTGTGG + Intronic
977650324 4:99461632-99461654 GCTCATTTATGGTCGCCTGGGGG - Intergenic
984680559 4:182604169-182604191 TCACATTGATTGTCTCCAGCAGG - Intronic
988079560 5:26399499-26399521 TCATATTGTTTGTTTCCTGGTGG + Intergenic
989136504 5:38161274-38161296 TAATATTGATGATCTCCTAGGGG - Intergenic
994979096 5:106849776-106849798 TCAGATGGATGGTCTCATGAAGG - Intergenic
996758805 5:126966155-126966177 TCACATCAGTGGTTTCCTGGAGG + Intronic
997721218 5:136079619-136079641 TCGCAGTGATGGGCTCCTGGGGG - Intergenic
997878045 5:137566380-137566402 TCACATTGACAGTCTAGTGGGGG - Intronic
1015090295 6:129347786-129347808 TCACATAAAAGGTCTTCTGGAGG - Intronic
1015879015 6:137852281-137852303 TCACATTGATGGTCCAATTGGGG - Intergenic
1019037844 6:169076697-169076719 ACATATTGATGGTGTCCTGCAGG - Intergenic
1021867794 7:24976456-24976478 TCACATTGGTCCTTTCCTGGAGG - Intronic
1021868114 7:24979201-24979223 TCACATTGGTCCTTTCCTGGAGG - Intronic
1022666556 7:32416387-32416409 TTACATTGTGAGTCTCCTGGAGG - Intergenic
1025875393 7:65476510-65476532 AGACATCGAGGGTCTCCTGGAGG - Intergenic
1027627573 7:80564376-80564398 TCACTTTACTTGTCTCCTGGGGG + Intronic
1028082962 7:86600362-86600384 CCACTTTGCTTGTCTCCTGGGGG - Intergenic
1030368795 7:108674314-108674336 CTGCATTGATGGTCTCATGGGGG + Intergenic
1031290804 7:119931018-119931040 TCACATTCATGGACTCCTGTAGG - Intergenic
1031349180 7:120707605-120707627 GCACATTGCTAGACTCCTGGGGG + Intronic
1032059391 7:128711699-128711721 TTACAGTGATGTTCTCCAGGAGG + Intronic
1032542844 7:132717982-132718004 TCAGATTGCTGGTATCCTGTAGG + Intronic
1037538791 8:19852654-19852676 TCCCACTGATGGTCCCCTGAAGG + Intergenic
1039221017 8:35330922-35330944 TCACATTTGTGGTCTCCCTGGGG - Intronic
1040416781 8:47202692-47202714 TCACTCTCAGGGTCTCCTGGAGG - Intergenic
1041045938 8:53886052-53886074 TCACATTGTGAGTCACCTGGTGG - Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1049485673 8:142858761-142858783 TCAGATATCTGGTCTCCTGGTGG - Intronic
1055625661 9:78174868-78174890 TCACATAGATTGTCTAGTGGCGG + Intergenic
1056928155 9:90852293-90852315 TCACATTGCTGGGCTCCTCTTGG + Intronic
1057270305 9:93646684-93646706 TGAACTTGATGGCCTCCTGGTGG - Intronic
1060346690 9:122823018-122823040 TCCCACTGATCTTCTCCTGGAGG + Exonic
1061642115 9:131967312-131967334 TCACAGTGGTGGTGTCATGGGGG - Intronic
1188509474 X:30919998-30920020 TTACATTTAAGGTCTTCTGGAGG - Intronic
1189383552 X:40518835-40518857 ACACATGGAAGGTCACCTGGAGG - Intergenic
1190597436 X:52063010-52063032 TCATCTTGCTGGTCTCATGGCGG + Exonic
1190611388 X:52191063-52191085 TCATCTTGCTGGTCTCATGGCGG - Exonic
1190827873 X:54034313-54034335 TCAAATTGGTGTTCTCCTTGAGG - Intronic
1195346327 X:103954089-103954111 CCACTTTGCTTGTCTCCTGGGGG - Intronic
1195361126 X:104084756-104084778 CCACTTTGCTTGTCTCCTGGGGG + Intergenic
1197016827 X:121635196-121635218 TGGCATTCTTGGTCTCCTGGGGG - Intergenic
1197071891 X:122309274-122309296 TAACATAGATGTTCTGCTGGTGG - Intergenic
1198722143 X:139634656-139634678 TAACAGTCATGGCCTCCTGGGGG - Intronic
1200983753 Y:9285591-9285613 GCACATTGATGATCTTCTGCAGG - Intergenic
1201504647 Y:14684614-14684636 GCACCTTGATGCTCTCCTTGAGG - Intronic