ID: 1173450862

View in Genome Browser
Species Human (GRCh38)
Location 20:43162725-43162747
Sequence CATGGTTCCAACCACACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173450857_1173450862 -5 Left 1173450857 20:43162707-43162729 CCACACCAGTCAGTCACCCATGG 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1173450854_1173450862 7 Left 1173450854 20:43162695-43162717 CCTTCCCTTCAGCCACACCAGTC 0: 1
1: 1
2: 3
3: 62
4: 409
Right 1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1173450855_1173450862 3 Left 1173450855 20:43162699-43162721 CCCTTCAGCCACACCAGTCAGTC 0: 1
1: 0
2: 1
3: 15
4: 172
Right 1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1173450856_1173450862 2 Left 1173450856 20:43162700-43162722 CCTTCAGCCACACCAGTCAGTCA 0: 1
1: 0
2: 3
3: 23
4: 204
Right 1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1173450853_1173450862 8 Left 1173450853 20:43162694-43162716 CCCTTCCCTTCAGCCACACCAGT 0: 1
1: 0
2: 2
3: 38
4: 566
Right 1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1173450852_1173450862 9 Left 1173450852 20:43162693-43162715 CCCCTTCCCTTCAGCCACACCAG 0: 1
1: 0
2: 5
3: 87
4: 711
Right 1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1173450859_1173450862 -10 Left 1173450859 20:43162712-43162734 CCAGTCAGTCACCCATGGTTCCA 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1173450851_1173450862 16 Left 1173450851 20:43162686-43162708 CCTGGCTCCCCTTCCCTTCAGCC 0: 1
1: 1
2: 13
3: 82
4: 768
Right 1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173450862 Original CRISPR CATGGTTCCAACCACACCAA AGG Intronic
901139406 1:7018746-7018768 AATGGTTCCGACCCCAACAACGG - Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901402743 1:9025724-9025746 CATGGTTGCCACAACACCCAGGG + Intronic
902183562 1:14708253-14708275 CCTGATTCCAACCACACCTCTGG - Intronic
904708917 1:32413748-32413770 CCTGCTTCCAACCACCCCAGTGG + Intergenic
905338543 1:37262194-37262216 TACGTTTCCACCCACACCAATGG + Intergenic
906291565 1:44622766-44622788 CATGGCTCCAGGCACCCCAAAGG + Exonic
915338670 1:155163811-155163833 CATGGTGGGAACCACACCACTGG - Intergenic
916528523 1:165633648-165633670 TAGGGTACCAACCACCCCAAAGG - Intronic
916553396 1:165871626-165871648 CAAGATCCCAACCACATCAAAGG - Intronic
917638922 1:176963518-176963540 CATGGGTCAAACCACACAACTGG + Intronic
918822958 1:189282263-189282285 CATGCTTCTACCTACACCAAAGG - Intergenic
920871323 1:209797542-209797564 CATGCTGTCAACCACACCAGTGG + Intronic
922691607 1:227696631-227696653 CATGGTCCCAACCACAACACTGG + Intergenic
923250749 1:232177618-232177640 CATCATGCCAAACACACCAAAGG - Intergenic
923352700 1:233125111-233125133 CATGGTGTCAACCTCACCAGTGG + Intronic
1063904558 10:10768388-10768410 CATGGCTCCAACCAAACTCATGG - Intergenic
1065318397 10:24486275-24486297 CATGGTTCCTATCACACTCAGGG + Intronic
1065364890 10:24925832-24925854 CAGAGTTCCAACCCCACCTAAGG - Intronic
1065892641 10:30134297-30134319 CATGGATCCAAACCCACCAAGGG + Intergenic
1071286441 10:84151270-84151292 CACAGCTCAAACCACACCAATGG + Intronic
1074313826 10:112344428-112344450 CATGGTGGCAACCACTCCATCGG - Intergenic
1075181100 10:120212652-120212674 CATGGCTCCATCCAGCCCAAGGG - Intergenic
1075512732 10:123085257-123085279 CCTGGTTTCACCCACAGCAATGG + Intergenic
1080756136 11:35201077-35201099 CACAGTTTCAACCACACCACGGG + Exonic
1085602346 11:77866562-77866584 CATTGATCCAGCCACTCCAATGG + Intronic
1095099087 12:38162849-38162871 CATGGCTCCCACCACACGGACGG - Intergenic
1095183092 12:39168539-39168561 CTAGGTCCCAACAACACCAAAGG - Intergenic
1098742257 12:74188018-74188040 TATGATTCCAAACAAACCAATGG + Intergenic
1105871735 13:24511564-24511586 CTTGATTCCACCTACACCAATGG - Intronic
1115101001 14:29699749-29699771 AATTGTTCCAACCCCACCTATGG + Intronic
1119213608 14:72851187-72851209 CATAGTTCTGACCTCACCAATGG - Intronic
1119396062 14:74327147-74327169 CATTGTTCCAAGCACACAATAGG - Intronic
1125159174 15:36623644-36623666 CAGCATTCCAACCACACCATAGG - Intronic
1127279307 15:57475293-57475315 CTTGGTGCCAGCCACACTAAAGG + Intronic
1128729759 15:70013326-70013348 CATGGCTCTAACCACTCCACTGG - Intergenic
1131865203 15:96701074-96701096 CATGCTTCCAGCCACAAAAAAGG - Intergenic
1132317521 15:100900766-100900788 CATGGTTTCACACACACCAGGGG - Intronic
1133584194 16:7176080-7176102 CATGCTCCTAACCACACCAGCGG - Intronic
1135778556 16:25278468-25278490 CAGGCTTCCAAGCACAGCAAGGG + Intergenic
1142031612 16:87841322-87841344 CAGGGTTCCAACCACAACCAGGG + Intronic
1142122503 16:88393799-88393821 CATGGTTCCAACCACAAGTGGGG + Intergenic
1142380114 16:89727126-89727148 CATGGCCCCATCCCCACCAAGGG - Intronic
1144262524 17:13536498-13536520 CATGGTTCCAAAAACAGGAAGGG + Intronic
1144669675 17:17125903-17125925 CATGGTTACCACCACACCAGGGG - Intronic
1144949757 17:18987662-18987684 CATGGTTTCCCCCACCCCAAAGG + Intronic
1150822016 17:68442783-68442805 CATGGTTCCACCCCTGCCAAAGG + Intronic
1151079912 17:71317225-71317247 CATCATTCAAACCACAGCAAAGG - Intergenic
1155056899 18:22192994-22193016 CAAGGTTATAGCCACACCAAGGG - Intronic
1157732101 18:50012870-50012892 CATGGGTCCAACCACAGGAGAGG + Intronic
1168187480 19:54709297-54709319 CTGGGTTCCGACCACACCCAGGG - Intergenic
925607266 2:5672360-5672382 CATGGTTCAAACCAGACCACGGG + Intergenic
930311417 2:49745335-49745357 CCTGAATCTAACCACACCAAGGG + Intergenic
932196654 2:69789709-69789731 CCTGGTCCCAACCAAACCACTGG - Intronic
933810108 2:86027784-86027806 CATGGTTCCTTGCACACCAGTGG - Intronic
937053439 2:118911039-118911061 CATGGTTCCAACTAAATCAAGGG + Intergenic
941142396 2:161801450-161801472 CATAGTCCCAACTACACCTAAGG - Intronic
942014189 2:171794359-171794381 CATGGCTACACCCACACAAAAGG + Intronic
946823730 2:223655631-223655653 CAGGCCTCCAACCTCACCAATGG + Intergenic
948586911 2:239025600-239025622 CATGGTCCCTGCCACACCCATGG + Intergenic
949004883 2:241639686-241639708 CCTGGACCCAGCCACACCAAGGG - Intronic
1169010517 20:2246218-2246240 CAAGATTCCAAAAACACCAAGGG + Intergenic
1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG + Intronic
1174097130 20:48098306-48098328 CTGGGTTCCAACCACATGAAAGG - Intergenic
1178254048 21:31034447-31034469 CATTGTTCCAGCCACACTAAAGG - Intergenic
1178605974 21:34036765-34036787 AATGGGTACAACCTCACCAATGG - Intergenic
1178806347 21:35842884-35842906 GATGGTGCCCACCACACCAAGGG - Intronic
1180258227 21:46648966-46648988 CATGAGACCAACCACACCCAAGG - Intronic
1182073677 22:27480465-27480487 CCTGCTTCCAACCACGCCACTGG + Intergenic
949598367 3:5572255-5572277 CATTGTCCAAACCACACAAATGG - Intergenic
949754336 3:7392093-7392115 CTCAGTTCAAACCACACCAAAGG - Intronic
952496956 3:33924451-33924473 CTTGGTGCCAGCCACACAAATGG - Intergenic
952683675 3:36124476-36124498 CTTGGTGCCAACCCCACCACAGG - Intergenic
952729686 3:36625845-36625867 CATGGTTCCAACCACATGATGGG + Intergenic
956889920 3:73602634-73602656 AATATTTCAAACCACACCAAAGG + Intronic
962839266 3:139219087-139219109 AATGTTTTCAACCACAACAATGG - Intronic
962920613 3:139947128-139947150 GATGGTTCCAAACCTACCAAGGG + Intronic
965669687 3:171134400-171134422 TATGGTCCCAGCTACACCAAAGG - Intronic
967267672 3:187705001-187705023 CATGCTTCCCAGCACCCCAAAGG + Intronic
970338098 4:15074132-15074154 CCTAGTTCTAACTACACCAATGG + Intergenic
972590784 4:40484510-40484532 CATGATCCCAACCATACCTAAGG - Intronic
972745021 4:41924210-41924232 CAGGGCTCCATCCACACCAAAGG + Intergenic
974187042 4:58458863-58458885 GCTGGTTCCAAGCAAACCAACGG - Intergenic
975327190 4:73071950-73071972 CATGGTGCCAAACACAGGAATGG + Intergenic
976644333 4:87371888-87371910 CAGGGTTGCAACCACACAAGGGG - Intronic
978937491 4:114395743-114395765 CATAGATCCCACCACACCCAAGG - Intergenic
979361763 4:119773687-119773709 CACTATTGCAACCACACCAAAGG + Intergenic
983151906 4:164294424-164294446 CATAGCTCCAGCCACACCAACGG + Intronic
985525956 5:401817-401839 CATGTTCCCAACCAAAGCAAGGG + Intronic
985640882 5:1063039-1063061 CATGGTTCCATCCAGCACAAGGG + Intronic
985853710 5:2408774-2408796 CAGGGTTCAAACCACACTCAGGG - Intergenic
987401725 5:17485345-17485367 CATGGTTTCATCCACACTCAGGG - Intergenic
987409835 5:17604036-17604058 CATGCTTCCGCCCACACCCAAGG - Intergenic
987412743 5:17631340-17631362 CATGCTTCCGCCCACACCCAAGG - Intergenic
987950749 5:24672745-24672767 CAGGGTTCCAAACAGACCTAAGG - Intergenic
992382467 5:76251619-76251641 CCTGGTTCCATCCAGACCACTGG - Intronic
995321789 5:110842977-110842999 TAGGGGTCCATCCACACCAAGGG + Intergenic
1000043915 5:157505770-157505792 CATGGTGGCAGCCACGCCAATGG + Exonic
1002066962 5:176656712-176656734 CAGGGCTTCATCCACACCAAAGG + Exonic
1017815746 6:158015375-158015397 AATGGTTCCATCCAGCCCAAGGG + Intronic
1018061093 6:160090406-160090428 CATGGTTAAAACCAAATCAAAGG - Intronic
1018171916 6:161150507-161150529 CATATTCCCAACCAGACCAAGGG - Intronic
1018244027 6:161804520-161804542 TATGGGTCCAACCTCACCAGTGG - Intronic
1021524518 7:21572435-21572457 CATATTTCCAACCACAGGAAAGG + Intronic
1021987870 7:26114637-26114659 GCTAGTTCCAACCACACAAAAGG - Intergenic
1022354659 7:29601695-29601717 CATGGTTCCACCCATACTTAAGG + Intergenic
1023089756 7:36606958-36606980 CATGGTTCCAGAGACACAAAGGG - Intronic
1028918655 7:96287384-96287406 CATAGTCCCAGCCACCCCAAGGG + Intronic
1032100282 7:128970755-128970777 CATAGTCCCAGCCACTCCAAAGG + Intronic
1036386658 8:8287594-8287616 TGGGGTTCCAACCACGCCAATGG + Intergenic
1037854991 8:22365640-22365662 CTTGTTTTCAACCACACTAAAGG - Intergenic
1039034003 8:33339456-33339478 CAGGGTTCCAAATACACAAATGG - Intergenic
1042863280 8:73334708-73334730 CTGGGTACCAACCACTCCAAGGG - Intergenic
1043526344 8:81100618-81100640 CATGGATCAAACCAAACCGATGG + Intronic
1043603727 8:81973618-81973640 CATTGTTAAAACCACAACAAGGG + Intergenic
1044084884 8:87932315-87932337 CATGGGTAAAACAACACCAAGGG + Intergenic
1049409543 8:142466361-142466383 CATGGTTCTACCCACAACACGGG + Intronic
1057886365 9:98833037-98833059 CATGGATCCACCCACACCCCAGG - Intronic
1058670158 9:107354537-107354559 CATGGTTCCACTCTGACCAAAGG - Intergenic
1059191931 9:112334183-112334205 CATCGTCCCAGCCACACCTATGG - Intergenic
1186077140 X:5892906-5892928 CATGATTCCAAACACACTGACGG - Exonic
1189728046 X:43988560-43988582 CATGGTCCCATCCACAACAAGGG - Intergenic
1191661812 X:63659263-63659285 CCTGGTTCCAACAAGACCACAGG - Intronic
1198080771 X:133237079-133237101 CATGGTTTCAGCCACATAAAAGG + Intergenic
1199408812 X:147495004-147495026 CTTGGTTCCCACCACAACTATGG - Intergenic