ID: 1173454307

View in Genome Browser
Species Human (GRCh38)
Location 20:43190611-43190633
Sequence TCCCCACCACCACGCGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173454294_1173454307 28 Left 1173454294 20:43190560-43190582 CCTCAATTAGCCGCCCACCCCAC No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454297_1173454307 14 Left 1173454297 20:43190574-43190596 CCACCCCACCTTCTTCTTCACCC No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454293_1173454307 29 Left 1173454293 20:43190559-43190581 CCCTCAATTAGCCGCCCACCCCA No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454300_1173454307 9 Left 1173454300 20:43190579-43190601 CCACCTTCTTCTTCACCCACATC No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454295_1173454307 18 Left 1173454295 20:43190570-43190592 CCGCCCACCCCACCTTCTTCTTC No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454299_1173454307 10 Left 1173454299 20:43190578-43190600 CCCACCTTCTTCTTCACCCACAT No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454303_1173454307 -7 Left 1173454303 20:43190595-43190617 CCACATCTCTCTCTTGTCCCCAC No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454298_1173454307 11 Left 1173454298 20:43190577-43190599 CCCCACCTTCTTCTTCACCCACA No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454292_1173454307 30 Left 1173454292 20:43190558-43190580 CCCCTCAATTAGCCGCCCACCCC No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454296_1173454307 15 Left 1173454296 20:43190573-43190595 CCCACCCCACCTTCTTCTTCACC No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454302_1173454307 -6 Left 1173454302 20:43190594-43190616 CCCACATCTCTCTCTTGTCCCCA No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data
1173454301_1173454307 6 Left 1173454301 20:43190582-43190604 CCTTCTTCTTCACCCACATCTCT No data
Right 1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173454307 Original CRISPR TCCCCACCACCACGCGGAAG GGG Intergenic
No off target data available for this crispr