ID: 1173454508

View in Genome Browser
Species Human (GRCh38)
Location 20:43191548-43191570
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173454501_1173454508 13 Left 1173454501 20:43191512-43191534 CCTTACTCTGTGCTGTTCTCTGG No data
Right 1173454508 20:43191548-43191570 CTATAGCCCTTAGGGACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173454508 Original CRISPR CTATAGCCCTTAGGGACAAT TGG Intergenic
No off target data available for this crispr