ID: 1173454543

View in Genome Browser
Species Human (GRCh38)
Location 20:43191737-43191759
Sequence GCTTAGAAATCTCCCCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173454543_1173454548 26 Left 1173454543 20:43191737-43191759 CCCGGGTGGGGAGATTTCTAAGC No data
Right 1173454548 20:43191786-43191808 TAACTTGTTGCCACTTTCTTGGG No data
1173454543_1173454547 25 Left 1173454543 20:43191737-43191759 CCCGGGTGGGGAGATTTCTAAGC No data
Right 1173454547 20:43191785-43191807 GTAACTTGTTGCCACTTTCTTGG No data
1173454543_1173454545 -8 Left 1173454543 20:43191737-43191759 CCCGGGTGGGGAGATTTCTAAGC No data
Right 1173454545 20:43191752-43191774 TTCTAAGCCACTAAAGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173454543 Original CRISPR GCTTAGAAATCTCCCCACCC GGG (reversed) Intergenic
No off target data available for this crispr