ID: 1173454622

View in Genome Browser
Species Human (GRCh38)
Location 20:43192199-43192221
Sequence TTCCAGGCAGAGGGACTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173454622_1173454633 24 Left 1173454622 20:43192199-43192221 CCGGCCAGTCCCTCTGCCTGGAA No data
Right 1173454633 20:43192246-43192268 GGAAACTCACACTAGCCCTTAGG No data
1173454622_1173454629 2 Left 1173454622 20:43192199-43192221 CCGGCCAGTCCCTCTGCCTGGAA No data
Right 1173454629 20:43192224-43192246 CCTGCACTGTATCATCTCCCTGG No data
1173454622_1173454634 25 Left 1173454622 20:43192199-43192221 CCGGCCAGTCCCTCTGCCTGGAA No data
Right 1173454634 20:43192247-43192269 GAAACTCACACTAGCCCTTAGGG No data
1173454622_1173454630 3 Left 1173454622 20:43192199-43192221 CCGGCCAGTCCCTCTGCCTGGAA No data
Right 1173454630 20:43192225-43192247 CTGCACTGTATCATCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173454622 Original CRISPR TTCCAGGCAGAGGGACTGGC CGG (reversed) Intergenic
No off target data available for this crispr