ID: 1173454630

View in Genome Browser
Species Human (GRCh38)
Location 20:43192225-43192247
Sequence CTGCACTGTATCATCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173454617_1173454630 28 Left 1173454617 20:43192174-43192196 CCCACAGCACTGCCACGCTTTTG No data
Right 1173454630 20:43192225-43192247 CTGCACTGTATCATCTCCCTGGG No data
1173454618_1173454630 27 Left 1173454618 20:43192175-43192197 CCACAGCACTGCCACGCTTTTGC No data
Right 1173454630 20:43192225-43192247 CTGCACTGTATCATCTCCCTGGG No data
1173454624_1173454630 -6 Left 1173454624 20:43192208-43192230 CCCTCTGCCTGGAAGCCCTGCAC No data
Right 1173454630 20:43192225-43192247 CTGCACTGTATCATCTCCCTGGG No data
1173454622_1173454630 3 Left 1173454622 20:43192199-43192221 CCGGCCAGTCCCTCTGCCTGGAA No data
Right 1173454630 20:43192225-43192247 CTGCACTGTATCATCTCCCTGGG No data
1173454623_1173454630 -1 Left 1173454623 20:43192203-43192225 CCAGTCCCTCTGCCTGGAAGCCC No data
Right 1173454630 20:43192225-43192247 CTGCACTGTATCATCTCCCTGGG No data
1173454620_1173454630 16 Left 1173454620 20:43192186-43192208 CCACGCTTTTGCACCGGCCAGTC No data
Right 1173454630 20:43192225-43192247 CTGCACTGTATCATCTCCCTGGG No data
1173454625_1173454630 -7 Left 1173454625 20:43192209-43192231 CCTCTGCCTGGAAGCCCTGCACT No data
Right 1173454630 20:43192225-43192247 CTGCACTGTATCATCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173454630 Original CRISPR CTGCACTGTATCATCTCCCT GGG Intergenic
No off target data available for this crispr