ID: 1173454634

View in Genome Browser
Species Human (GRCh38)
Location 20:43192247-43192269
Sequence GAAACTCACACTAGCCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173454627_1173454634 1 Left 1173454627 20:43192223-43192245 CCCTGCACTGTATCATCTCCCTG No data
Right 1173454634 20:43192247-43192269 GAAACTCACACTAGCCCTTAGGG No data
1173454622_1173454634 25 Left 1173454622 20:43192199-43192221 CCGGCCAGTCCCTCTGCCTGGAA No data
Right 1173454634 20:43192247-43192269 GAAACTCACACTAGCCCTTAGGG No data
1173454626_1173454634 9 Left 1173454626 20:43192215-43192237 CCTGGAAGCCCTGCACTGTATCA No data
Right 1173454634 20:43192247-43192269 GAAACTCACACTAGCCCTTAGGG No data
1173454623_1173454634 21 Left 1173454623 20:43192203-43192225 CCAGTCCCTCTGCCTGGAAGCCC No data
Right 1173454634 20:43192247-43192269 GAAACTCACACTAGCCCTTAGGG No data
1173454625_1173454634 15 Left 1173454625 20:43192209-43192231 CCTCTGCCTGGAAGCCCTGCACT No data
Right 1173454634 20:43192247-43192269 GAAACTCACACTAGCCCTTAGGG No data
1173454624_1173454634 16 Left 1173454624 20:43192208-43192230 CCCTCTGCCTGGAAGCCCTGCAC No data
Right 1173454634 20:43192247-43192269 GAAACTCACACTAGCCCTTAGGG No data
1173454628_1173454634 0 Left 1173454628 20:43192224-43192246 CCTGCACTGTATCATCTCCCTGG No data
Right 1173454634 20:43192247-43192269 GAAACTCACACTAGCCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173454634 Original CRISPR GAAACTCACACTAGCCCTTA GGG Intergenic
No off target data available for this crispr