ID: 1173455767

View in Genome Browser
Species Human (GRCh38)
Location 20:43200008-43200030
Sequence CAGGGTCTATCTGGGTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173455767_1173455775 2 Left 1173455767 20:43200008-43200030 CCCCCATACCCAGATAGACCCTG No data
Right 1173455775 20:43200033-43200055 ATTTTTGTTGTTGTTGAGACAGG No data
1173455767_1173455777 8 Left 1173455767 20:43200008-43200030 CCCCCATACCCAGATAGACCCTG No data
Right 1173455777 20:43200039-43200061 GTTGTTGTTGAGACAGGGTCTGG No data
1173455767_1173455776 3 Left 1173455767 20:43200008-43200030 CCCCCATACCCAGATAGACCCTG No data
Right 1173455776 20:43200034-43200056 TTTTTGTTGTTGTTGAGACAGGG 0: 64
1: 341
2: 946
3: 20189
4: 38015
1173455767_1173455779 26 Left 1173455767 20:43200008-43200030 CCCCCATACCCAGATAGACCCTG No data
Right 1173455779 20:43200057-43200079 TCTGGCTCTGTCGCCTAGGCTGG 0: 63
1: 3206
2: 56177
3: 155347
4: 206373
1173455767_1173455778 22 Left 1173455767 20:43200008-43200030 CCCCCATACCCAGATAGACCCTG No data
Right 1173455778 20:43200053-43200075 AGGGTCTGGCTCTGTCGCCTAGG 0: 10
1: 329
2: 4743
3: 37643
4: 137761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173455767 Original CRISPR CAGGGTCTATCTGGGTATGG GGG (reversed) Intergenic
No off target data available for this crispr