ID: 1173458754

View in Genome Browser
Species Human (GRCh38)
Location 20:43224926-43224948
Sequence TGCCGAGTGCTCTTGCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173458754_1173458759 10 Left 1173458754 20:43224926-43224948 CCCCTTTGCAAGAGCACTCGGCA No data
Right 1173458759 20:43224959-43224981 GCAGAGAAAATAATTTGCTCAGG No data
1173458754_1173458760 27 Left 1173458754 20:43224926-43224948 CCCCTTTGCAAGAGCACTCGGCA No data
Right 1173458760 20:43224976-43224998 CTCAGGAGCCCATTTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173458754 Original CRISPR TGCCGAGTGCTCTTGCAAAG GGG (reversed) Intergenic
No off target data available for this crispr