ID: 1173461528

View in Genome Browser
Species Human (GRCh38)
Location 20:43246952-43246974
Sequence CTGGGAAGACACAGGCAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173461519_1173461528 9 Left 1173461519 20:43246920-43246942 CCCTTCAAGTCCAGGATCAGCCA No data
Right 1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG No data
1173461521_1173461528 -1 Left 1173461521 20:43246930-43246952 CCAGGATCAGCCATTCCTTCCTC No data
Right 1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG No data
1173461516_1173461528 28 Left 1173461516 20:43246901-43246923 CCCACAGAACTCTGACTCTCCCT No data
Right 1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG No data
1173461517_1173461528 27 Left 1173461517 20:43246902-43246924 CCACAGAACTCTGACTCTCCCTT No data
Right 1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG No data
1173461520_1173461528 8 Left 1173461520 20:43246921-43246943 CCTTCAAGTCCAGGATCAGCCAT No data
Right 1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173461528 Original CRISPR CTGGGAAGACACAGGCAGTA TGG Intergenic
No off target data available for this crispr