ID: 1173463197

View in Genome Browser
Species Human (GRCh38)
Location 20:43260477-43260499
Sequence GGTGGCCTGGTACCCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463197_1173463204 13 Left 1173463197 20:43260477-43260499 CCATCTTGGGGTACCAGGCCACC No data
Right 1173463204 20:43260513-43260535 GACACTGTTTGACAAAGAAAGGG No data
1173463197_1173463203 12 Left 1173463197 20:43260477-43260499 CCATCTTGGGGTACCAGGCCACC No data
Right 1173463203 20:43260512-43260534 CGACACTGTTTGACAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463197 Original CRISPR GGTGGCCTGGTACCCCAAGA TGG (reversed) Intergenic
No off target data available for this crispr