ID: 1173463203

View in Genome Browser
Species Human (GRCh38)
Location 20:43260512-43260534
Sequence CGACACTGTTTGACAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463197_1173463203 12 Left 1173463197 20:43260477-43260499 CCATCTTGGGGTACCAGGCCACC No data
Right 1173463203 20:43260512-43260534 CGACACTGTTTGACAAAGAAAGG No data
1173463200_1173463203 -6 Left 1173463200 20:43260495-43260517 CCACCTTTGGATCTCCTCGACAC No data
Right 1173463203 20:43260512-43260534 CGACACTGTTTGACAAAGAAAGG No data
1173463199_1173463203 -1 Left 1173463199 20:43260490-43260512 CCAGGCCACCTTTGGATCTCCTC No data
Right 1173463203 20:43260512-43260534 CGACACTGTTTGACAAAGAAAGG No data
1173463201_1173463203 -9 Left 1173463201 20:43260498-43260520 CCTTTGGATCTCCTCGACACTGT No data
Right 1173463203 20:43260512-43260534 CGACACTGTTTGACAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463203 Original CRISPR CGACACTGTTTGACAAAGAA AGG Intergenic
No off target data available for this crispr