ID: 1173463595

View in Genome Browser
Species Human (GRCh38)
Location 20:43263367-43263389
Sequence TAATGCAAAGTGGGGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463595_1173463609 17 Left 1173463595 20:43263367-43263389 CCCTCCCTCCCCACTTTGCATTA No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463595_1173463611 30 Left 1173463595 20:43263367-43263389 CCCTCCCTCCCCACTTTGCATTA No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463595 Original CRISPR TAATGCAAAGTGGGGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr