ID: 1173463596

View in Genome Browser
Species Human (GRCh38)
Location 20:43263368-43263390
Sequence GTAATGCAAAGTGGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463596_1173463611 29 Left 1173463596 20:43263368-43263390 CCTCCCTCCCCACTTTGCATTAC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463596_1173463609 16 Left 1173463596 20:43263368-43263390 CCTCCCTCCCCACTTTGCATTAC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463596 Original CRISPR GTAATGCAAAGTGGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr