ID: 1173463597

View in Genome Browser
Species Human (GRCh38)
Location 20:43263371-43263393
Sequence GGGGTAATGCAAAGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463597_1173463611 26 Left 1173463597 20:43263371-43263393 CCCTCCCCACTTTGCATTACCCC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463597_1173463609 13 Left 1173463597 20:43263371-43263393 CCCTCCCCACTTTGCATTACCCC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463597 Original CRISPR GGGGTAATGCAAAGTGGGGA GGG (reversed) Intergenic