ID: 1173463605

View in Genome Browser
Species Human (GRCh38)
Location 20:43263393-43263415
Sequence TTTATGTGTGTGTGTCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463605_1173463613 26 Left 1173463605 20:43263393-43263415 CCTCCCCGACACACACACATAAA No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data
1173463605_1173463614 27 Left 1173463605 20:43263393-43263415 CCTCCCCGACACACACACATAAA No data
Right 1173463614 20:43263443-43263465 TTTTGAGATAAACAAAACCAGGG No data
1173463605_1173463609 -9 Left 1173463605 20:43263393-43263415 CCTCCCCGACACACACACATAAA No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463605_1173463611 4 Left 1173463605 20:43263393-43263415 CCTCCCCGACACACACACATAAA No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463605 Original CRISPR TTTATGTGTGTGTGTCGGGG AGG (reversed) Intergenic
No off target data available for this crispr