ID: 1173463609

View in Genome Browser
Species Human (GRCh38)
Location 20:43263407-43263429
Sequence ACACATAAACATCCACACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463596_1173463609 16 Left 1173463596 20:43263368-43263390 CCTCCCTCCCCACTTTGCATTAC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463604_1173463609 -8 Left 1173463604 20:43263392-43263414 CCCTCCCCGACACACACACATAA No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463605_1173463609 -9 Left 1173463605 20:43263393-43263415 CCTCCCCGACACACACACATAAA No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463593_1173463609 21 Left 1173463593 20:43263363-43263385 CCCTCCCTCCCTCCCCACTTTGC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463599_1173463609 9 Left 1173463599 20:43263375-43263397 CCCCACTTTGCATTACCCCCTCC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463600_1173463609 8 Left 1173463600 20:43263376-43263398 CCCACTTTGCATTACCCCCTCCC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463598_1173463609 12 Left 1173463598 20:43263372-43263394 CCTCCCCACTTTGCATTACCCCC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463603_1173463609 -7 Left 1173463603 20:43263391-43263413 CCCCTCCCCGACACACACACATA No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463602_1173463609 -6 Left 1173463602 20:43263390-43263412 CCCCCTCCCCGACACACACACAT No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463597_1173463609 13 Left 1173463597 20:43263371-43263393 CCCTCCCCACTTTGCATTACCCC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463601_1173463609 7 Left 1173463601 20:43263377-43263399 CCACTTTGCATTACCCCCTCCCC No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463595_1173463609 17 Left 1173463595 20:43263367-43263389 CCCTCCCTCCCCACTTTGCATTA No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data
1173463594_1173463609 20 Left 1173463594 20:43263364-43263386 CCTCCCTCCCTCCCCACTTTGCA No data
Right 1173463609 20:43263407-43263429 ACACATAAACATCCACACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463609 Original CRISPR ACACATAAACATCCACACTC TGG Intergenic
No off target data available for this crispr