ID: 1173463611

View in Genome Browser
Species Human (GRCh38)
Location 20:43263420-43263442
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463601_1173463611 20 Left 1173463601 20:43263377-43263399 CCACTTTGCATTACCCCCTCCCC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463600_1173463611 21 Left 1173463600 20:43263376-43263398 CCCACTTTGCATTACCCCCTCCC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463602_1173463611 7 Left 1173463602 20:43263390-43263412 CCCCCTCCCCGACACACACACAT No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463606_1173463611 1 Left 1173463606 20:43263396-43263418 CCCCGACACACACACATAAACAT No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463598_1173463611 25 Left 1173463598 20:43263372-43263394 CCTCCCCACTTTGCATTACCCCC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463605_1173463611 4 Left 1173463605 20:43263393-43263415 CCTCCCCGACACACACACATAAA No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463603_1173463611 6 Left 1173463603 20:43263391-43263413 CCCCTCCCCGACACACACACATA No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463595_1173463611 30 Left 1173463595 20:43263367-43263389 CCCTCCCTCCCCACTTTGCATTA No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463597_1173463611 26 Left 1173463597 20:43263371-43263393 CCCTCCCCACTTTGCATTACCCC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463604_1173463611 5 Left 1173463604 20:43263392-43263414 CCCTCCCCGACACACACACATAA No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463596_1173463611 29 Left 1173463596 20:43263368-43263390 CCTCCCTCCCCACTTTGCATTAC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463608_1173463611 -1 Left 1173463608 20:43263398-43263420 CCGACACACACACATAAACATCC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463607_1173463611 0 Left 1173463607 20:43263397-43263419 CCCGACACACACACATAAACATC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data
1173463599_1173463611 22 Left 1173463599 20:43263375-43263397 CCCCACTTTGCATTACCCCCTCC No data
Right 1173463611 20:43263420-43263442 CACACTCTGGCACTAAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463611 Original CRISPR CACACTCTGGCACTAAGCCT AGG Intergenic