ID: 1173463613

View in Genome Browser
Species Human (GRCh38)
Location 20:43263442-43263464
Sequence GTTTTGAGATAAACAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173463606_1173463613 23 Left 1173463606 20:43263396-43263418 CCCCGACACACACACATAAACAT No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data
1173463605_1173463613 26 Left 1173463605 20:43263393-43263415 CCTCCCCGACACACACACATAAA No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data
1173463610_1173463613 0 Left 1173463610 20:43263419-43263441 CCACACTCTGGCACTAAGCCTAG No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data
1173463602_1173463613 29 Left 1173463602 20:43263390-43263412 CCCCCTCCCCGACACACACACAT No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data
1173463607_1173463613 22 Left 1173463607 20:43263397-43263419 CCCGACACACACACATAAACATC No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data
1173463608_1173463613 21 Left 1173463608 20:43263398-43263420 CCGACACACACACATAAACATCC No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data
1173463604_1173463613 27 Left 1173463604 20:43263392-43263414 CCCTCCCCGACACACACACATAA No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data
1173463603_1173463613 28 Left 1173463603 20:43263391-43263413 CCCCTCCCCGACACACACACATA No data
Right 1173463613 20:43263442-43263464 GTTTTGAGATAAACAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173463613 Original CRISPR GTTTTGAGATAAACAAAACC AGG Intergenic