ID: 1173465516

View in Genome Browser
Species Human (GRCh38)
Location 20:43278157-43278179
Sequence TTCCAAGGCAATTTTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173465516_1173465518 4 Left 1173465516 20:43278157-43278179 CCAGGCACAAAATTGCCTTGGAA No data
Right 1173465518 20:43278184-43278206 TTTTCAATTTTAAGAGACCCTGG No data
1173465516_1173465519 19 Left 1173465516 20:43278157-43278179 CCAGGCACAAAATTGCCTTGGAA No data
Right 1173465519 20:43278199-43278221 GACCCTGGAGCACCTAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173465516 Original CRISPR TTCCAAGGCAATTTTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr