ID: 1173468042

View in Genome Browser
Species Human (GRCh38)
Location 20:43299978-43300000
Sequence CAGAGCCATGTGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173468034_1173468042 30 Left 1173468034 20:43299925-43299947 CCCTGTAACTTGTGTCCTCCCTA No data
Right 1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG No data
1173468038_1173468042 11 Left 1173468038 20:43299944-43299966 CCTAAAATGTGAGCTGCAACGTG No data
Right 1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG No data
1173468035_1173468042 29 Left 1173468035 20:43299926-43299948 CCTGTAACTTGTGTCCTCCCTAA No data
Right 1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG No data
1173468037_1173468042 12 Left 1173468037 20:43299943-43299965 CCCTAAAATGTGAGCTGCAACGT No data
Right 1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG No data
1173468036_1173468042 15 Left 1173468036 20:43299940-43299962 CCTCCCTAAAATGTGAGCTGCAA No data
Right 1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173468042 Original CRISPR CAGAGCCATGTGAAAGTGGA AGG Intergenic
No off target data available for this crispr