ID: 1173469476

View in Genome Browser
Species Human (GRCh38)
Location 20:43311669-43311691
Sequence CACAAAAGAGAGAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173469466_1173469476 24 Left 1173469466 20:43311622-43311644 CCATATTATAAATCCAATAAATT No data
Right 1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG No data
1173469467_1173469476 11 Left 1173469467 20:43311635-43311657 CCAATAAATTCACATAATGCTAT No data
Right 1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173469476 Original CRISPR CACAAAAGAGAGAAGGAGGG GGG Intergenic
No off target data available for this crispr