ID: 1173471045

View in Genome Browser
Species Human (GRCh38)
Location 20:43323903-43323925
Sequence CCAGGCTTCATACAGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173471031_1173471045 21 Left 1173471031 20:43323859-43323881 CCTAGGGTCAAGGTGTTCTGATT No data
Right 1173471045 20:43323903-43323925 CCAGGCTTCATACAGGGTGCTGG No data
1173471030_1173471045 22 Left 1173471030 20:43323858-43323880 CCCTAGGGTCAAGGTGTTCTGAT No data
Right 1173471045 20:43323903-43323925 CCAGGCTTCATACAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173471045 Original CRISPR CCAGGCTTCATACAGGGTGC TGG Intergenic
No off target data available for this crispr