ID: 1173475195

View in Genome Browser
Species Human (GRCh38)
Location 20:43353729-43353751
Sequence TGGGGAGCCCTCTGAATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173475191_1173475195 -2 Left 1173475191 20:43353708-43353730 CCATACACATATCATGGCAGCTG No data
Right 1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG No data
1173475184_1173475195 27 Left 1173475184 20:43353679-43353701 CCGGGGCAAAAGGACCTGCTATG No data
Right 1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG No data
1173475185_1173475195 13 Left 1173475185 20:43353693-43353715 CCTGCTATGCCCTCCCCATACAC No data
Right 1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG No data
1173475189_1173475195 0 Left 1173475189 20:43353706-43353728 CCCCATACACATATCATGGCAGC No data
Right 1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG No data
1173475186_1173475195 4 Left 1173475186 20:43353702-43353724 CCCTCCCCATACACATATCATGG No data
Right 1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG No data
1173475188_1173475195 3 Left 1173475188 20:43353703-43353725 CCTCCCCATACACATATCATGGC No data
Right 1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG No data
1173475190_1173475195 -1 Left 1173475190 20:43353707-43353729 CCCATACACATATCATGGCAGCT No data
Right 1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173475195 Original CRISPR TGGGGAGCCCTCTGAATAAC AGG Intergenic
No off target data available for this crispr