ID: 1173480820

View in Genome Browser
Species Human (GRCh38)
Location 20:43397944-43397966
Sequence GGCTTAGAGACAGACCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173480820_1173480824 4 Left 1173480820 20:43397944-43397966 CCAGCCAGGTCTGTCTCTAAGCC No data
Right 1173480824 20:43397971-43397993 GCAGAAAGCTGAGCTACCCACGG No data
1173480820_1173480827 25 Left 1173480820 20:43397944-43397966 CCAGCCAGGTCTGTCTCTAAGCC No data
Right 1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173480820 Original CRISPR GGCTTAGAGACAGACCTGGC TGG (reversed) Intergenic
No off target data available for this crispr