ID: 1173480827

View in Genome Browser
Species Human (GRCh38)
Location 20:43397992-43398014
Sequence GGCTCCCAGATTCTCCCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173480819_1173480827 30 Left 1173480819 20:43397939-43397961 CCAGGCCAGCCAGGTCTGTCTCT No data
Right 1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG No data
1173480823_1173480827 4 Left 1173480823 20:43397965-43397987 CCTGGAGCAGAAAGCTGAGCTAC No data
Right 1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG No data
1173480822_1173480827 21 Left 1173480822 20:43397948-43397970 CCAGGTCTGTCTCTAAGCCTGGA No data
Right 1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG No data
1173480820_1173480827 25 Left 1173480820 20:43397944-43397966 CCAGCCAGGTCTGTCTCTAAGCC No data
Right 1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173480827 Original CRISPR GGCTCCCAGATTCTCCCTGA CGG Intergenic
No off target data available for this crispr