ID: 1173482709

View in Genome Browser
Species Human (GRCh38)
Location 20:43416050-43416072
Sequence GAGAATCCCAGAGTCCTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173482697_1173482709 28 Left 1173482697 20:43415999-43416021 CCCCCTCGGAACCCCCATTGCAA No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data
1173482701_1173482709 17 Left 1173482701 20:43416010-43416032 CCCCCATTGCAACTACAAACACC No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data
1173482702_1173482709 16 Left 1173482702 20:43416011-43416033 CCCCATTGCAACTACAAACACCT No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data
1173482704_1173482709 14 Left 1173482704 20:43416013-43416035 CCATTGCAACTACAAACACCTTC No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data
1173482703_1173482709 15 Left 1173482703 20:43416012-43416034 CCCATTGCAACTACAAACACCTT No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data
1173482698_1173482709 27 Left 1173482698 20:43416000-43416022 CCCCTCGGAACCCCCATTGCAAC No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data
1173482706_1173482709 -4 Left 1173482706 20:43416031-43416053 CCTTCAGTCCTCACTGCTGGAGA No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data
1173482699_1173482709 26 Left 1173482699 20:43416001-43416023 CCCTCGGAACCCCCATTGCAACT No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data
1173482700_1173482709 25 Left 1173482700 20:43416002-43416024 CCTCGGAACCCCCATTGCAACTA No data
Right 1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173482709 Original CRISPR GAGAATCCCAGAGTCCTCGA GGG Intergenic
No off target data available for this crispr