ID: 1173482839

View in Genome Browser
Species Human (GRCh38)
Location 20:43416704-43416726
Sequence TAGGGTTGTTTCTCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173482839_1173482844 7 Left 1173482839 20:43416704-43416726 CCTGCAACTGAGAAACAACCCTA No data
Right 1173482844 20:43416734-43416756 TCCCTGTTGGACAAAACCCCAGG No data
1173482839_1173482847 11 Left 1173482839 20:43416704-43416726 CCTGCAACTGAGAAACAACCCTA No data
Right 1173482847 20:43416738-43416760 TGTTGGACAAAACCCCAGGCTGG No data
1173482839_1173482841 -6 Left 1173482839 20:43416704-43416726 CCTGCAACTGAGAAACAACCCTA No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173482839 Original CRISPR TAGGGTTGTTTCTCAGTTGC AGG (reversed) Intergenic
No off target data available for this crispr