ID: 1173482841

View in Genome Browser
Species Human (GRCh38)
Location 20:43416721-43416743
Sequence ACCCTACAGGTGATCCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173482838_1173482841 -5 Left 1173482838 20:43416703-43416725 CCCTGCAACTGAGAAACAACCCT No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data
1173482834_1173482841 20 Left 1173482834 20:43416678-43416700 CCAGCCAAGCAACTGTGTGCCCA No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data
1173482837_1173482841 0 Left 1173482837 20:43416698-43416720 CCATGCCCTGCAACTGAGAAACA No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data
1173482839_1173482841 -6 Left 1173482839 20:43416704-43416726 CCTGCAACTGAGAAACAACCCTA No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data
1173482835_1173482841 16 Left 1173482835 20:43416682-43416704 CCAAGCAACTGTGTGCCCATGCC No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data
1173482833_1173482841 26 Left 1173482833 20:43416672-43416694 CCTAGGCCAGCCAAGCAACTGTG No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data
1173482831_1173482841 28 Left 1173482831 20:43416670-43416692 CCCCTAGGCCAGCCAAGCAACTG No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data
1173482836_1173482841 1 Left 1173482836 20:43416697-43416719 CCCATGCCCTGCAACTGAGAAAC No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data
1173482832_1173482841 27 Left 1173482832 20:43416671-43416693 CCCTAGGCCAGCCAAGCAACTGT No data
Right 1173482841 20:43416721-43416743 ACCCTACAGGTGATCCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173482841 Original CRISPR ACCCTACAGGTGATCCCTGT TGG Intergenic
No off target data available for this crispr