ID: 1173482844

View in Genome Browser
Species Human (GRCh38)
Location 20:43416734-43416756
Sequence TCCCTGTTGGACAAAACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173482839_1173482844 7 Left 1173482839 20:43416704-43416726 CCTGCAACTGAGAAACAACCCTA No data
Right 1173482844 20:43416734-43416756 TCCCTGTTGGACAAAACCCCAGG No data
1173482838_1173482844 8 Left 1173482838 20:43416703-43416725 CCCTGCAACTGAGAAACAACCCT No data
Right 1173482844 20:43416734-43416756 TCCCTGTTGGACAAAACCCCAGG No data
1173482836_1173482844 14 Left 1173482836 20:43416697-43416719 CCCATGCCCTGCAACTGAGAAAC No data
Right 1173482844 20:43416734-43416756 TCCCTGTTGGACAAAACCCCAGG No data
1173482837_1173482844 13 Left 1173482837 20:43416698-43416720 CCATGCCCTGCAACTGAGAAACA No data
Right 1173482844 20:43416734-43416756 TCCCTGTTGGACAAAACCCCAGG No data
1173482835_1173482844 29 Left 1173482835 20:43416682-43416704 CCAAGCAACTGTGTGCCCATGCC No data
Right 1173482844 20:43416734-43416756 TCCCTGTTGGACAAAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173482844 Original CRISPR TCCCTGTTGGACAAAACCCC AGG Intergenic
No off target data available for this crispr