ID: 1173487663

View in Genome Browser
Species Human (GRCh38)
Location 20:43453313-43453335
Sequence TTAAATTTAGGAATGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173487663_1173487671 27 Left 1173487663 20:43453313-43453335 CCAGCTTCCATTCCTAAATTTAA No data
Right 1173487671 20:43453363-43453385 TGTGTGGAATTGGTTCCTTCCGG No data
1173487663_1173487666 -1 Left 1173487663 20:43453313-43453335 CCAGCTTCCATTCCTAAATTTAA No data
Right 1173487666 20:43453335-43453357 ACAAAATTTCAGAGTCCCTGTGG No data
1173487663_1173487670 17 Left 1173487663 20:43453313-43453335 CCAGCTTCCATTCCTAAATTTAA No data
Right 1173487670 20:43453353-43453375 TGTGGTAGTGTGTGTGGAATTGG No data
1173487663_1173487667 11 Left 1173487663 20:43453313-43453335 CCAGCTTCCATTCCTAAATTTAA No data
Right 1173487667 20:43453347-43453369 AGTCCCTGTGGTAGTGTGTGTGG No data
1173487663_1173487672 30 Left 1173487663 20:43453313-43453335 CCAGCTTCCATTCCTAAATTTAA No data
Right 1173487672 20:43453366-43453388 GTGGAATTGGTTCCTTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173487663 Original CRISPR TTAAATTTAGGAATGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr