ID: 1173490141

View in Genome Browser
Species Human (GRCh38)
Location 20:43473157-43473179
Sequence GGGTAGATATGCAGGCAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173490134_1173490141 24 Left 1173490134 20:43473110-43473132 CCATATTTTAATTAAAAATTATT No data
Right 1173490141 20:43473157-43473179 GGGTAGATATGCAGGCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173490141 Original CRISPR GGGTAGATATGCAGGCAGGA CGG Intergenic
No off target data available for this crispr