ID: 1173496368

View in Genome Browser
Species Human (GRCh38)
Location 20:43521616-43521638
Sequence GCAATTTCACTAGTGTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173496367_1173496368 -5 Left 1173496367 20:43521598-43521620 CCTTAGTAACTGAAGAGAGCAAT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1173496368 20:43521616-43521638 GCAATTTCACTAGTGTGTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173496368 Original CRISPR GCAATTTCACTAGTGTGTAG AGG Intronic
906560741 1:46755058-46755080 GCAATTTTACTTCTGCGTAGAGG - Intergenic
909155805 1:72074755-72074777 GCAAATTCAATACTGTATAGAGG - Intronic
912317820 1:108682098-108682120 GCAATTTTACTTCTGTGCAGAGG - Intergenic
912859702 1:113202743-113202765 GCAATTTTACTTCTGTGCAGAGG - Intergenic
914208441 1:145556469-145556491 GCATTTAAAGTAGTGTGTAGAGG - Intergenic
919278513 1:195452956-195452978 GCACTTTCATTACAGTGTAGAGG + Intergenic
921226002 1:213019903-213019925 CTAATTTCAATATTGTGTAGGGG - Intergenic
923917274 1:238523241-238523263 TCATTTTCACTGCTGTGTAGAGG + Intergenic
1070992903 10:80747952-80747974 GCAATTTTACTTCTGTGCAGAGG - Intergenic
1071751811 10:88487532-88487554 CCATTTTAACGAGTGTGTAGTGG - Intronic
1071920797 10:90347693-90347715 GCAATTTTCCTAGTGTGTTTAGG + Intergenic
1071998480 10:91170563-91170585 GCCATTTCAATTGTGTATAGTGG - Intronic
1072517504 10:96199986-96200008 GCAGTTTCACTGGAGTGCAGTGG - Intronic
1076496550 10:130901296-130901318 TCATTTTCACTAGTGGGAAGAGG + Intergenic
1079285511 11:19127143-19127165 GCATTCTGACTAGTGTGAAGTGG + Intronic
1083141205 11:60723202-60723224 GGAATTTTACTAAAGTGTAGGGG - Intergenic
1086775659 11:90829605-90829627 GCAATGTAACTATAGTGTAGGGG + Intergenic
1086846060 11:91751085-91751107 GCAATCGCACTACTGGGTAGTGG - Intergenic
1097707119 12:62879836-62879858 CCAATTTAATTAGTGTGCAGAGG - Intronic
1103049222 12:117765019-117765041 GCTATTTAAAGAGTGTGTAGTGG + Intronic
1104322851 12:127768257-127768279 GCAATTTCTCTCTTGTGAAGTGG - Intergenic
1104761989 12:131302340-131302362 GCCTTTTCACTTGTGTGTGGTGG - Intergenic
1107556137 13:41518077-41518099 GGAAGTCCCCTAGTGTGTAGGGG + Intergenic
1109500148 13:63225199-63225221 GCAATTTCAAAAATGTGTATAGG + Intergenic
1109611246 13:64767410-64767432 GCAATTGCTCTACTGTCTAGTGG + Intergenic
1109818535 13:67620495-67620517 GCAATTTCAGTGCTGTGGAGAGG + Intergenic
1111444634 13:88331039-88331061 GCAATTTTACTTCTGTGCAGAGG - Intergenic
1111733265 13:92103596-92103618 GAAATTTCTCTAGTTTCTAGGGG - Intronic
1111939077 13:94589735-94589757 CCAATTTCAGTGCTGTGTAGTGG - Intronic
1112650227 13:101388903-101388925 GCCCTGTCACTTGTGTGTAGTGG - Intronic
1114756255 14:25263461-25263483 AAAATTTCACTAGTTTGTGGAGG + Intergenic
1115388759 14:32829346-32829368 ACAATTCCACTATTGTATAGTGG - Intronic
1118500460 14:66357395-66357417 GCTATTTCACTACTCTCTAGGGG + Intergenic
1118694632 14:68372213-68372235 GTGATTTCAGTAGAGTGTAGGGG + Intronic
1120324521 14:83008114-83008136 CCAATTACACTAGTGTGTACTGG + Intergenic
1123154996 14:106216241-106216263 GCAATTTCACTGCTGTGTTGTGG - Intergenic
1123401654 15:19993382-19993404 GCAATTTCACTGCTGTGTTGTGG - Intergenic
1123510997 15:21000043-21000065 GCAATTTCACTGCTGTGTTGTGG - Intergenic
1125825275 15:42671346-42671368 GCAATTTTACTTTTGTGCAGAGG + Intronic
1126462785 15:48930930-48930952 GCAGTTTCACTAGAGTGATGAGG - Intronic
1135110473 16:19687006-19687028 GCAATTGCAATAGTGTGCAGAGG - Intronic
1135979422 16:27135757-27135779 GCAATTTTACTTCTGTGCAGAGG - Intergenic
1141825250 16:86474283-86474305 GCCATTTCATAGGTGTGTAGAGG - Intergenic
1142553527 17:756064-756086 GCAATTTTACTTCTGTGCAGAGG + Intergenic
1143715921 17:8768894-8768916 GCAATTTTACTTCTGTGCAGAGG - Intergenic
1146804852 17:35856961-35856983 GCAATTATAATACTGTGTAGGGG + Intronic
1150234949 17:63585459-63585481 TGAATTTCACAAGTGTGGAGAGG - Intronic
1150953100 17:69824226-69824248 GCATTTACACTAGGGGGTAGGGG - Intergenic
1160271592 18:77390495-77390517 GCAATTAAACTAGTGTGTAGAGG - Intergenic
1162266647 19:9581203-9581225 GCAATTTTACTTCTGTGCAGAGG + Intronic
1163984416 19:20931645-20931667 GCAGTTTCACTGGAGTGCAGTGG + Intronic
1164550895 19:29211809-29211831 GCAATTTGGTTAGCGTGTAGGGG + Intronic
1166112675 19:40632430-40632452 GCAATTTCAGCAGTGCCTAGAGG - Intergenic
925366309 2:3314465-3314487 GAAATTTCACCAGTATGTTGAGG + Intronic
925775132 2:7328011-7328033 GCAATTTCAATACTGAGAAGGGG - Intergenic
926071606 2:9898161-9898183 GCAATTTCATTAATCTCTAGAGG + Intronic
926964698 2:18396994-18397016 TCAATTTCACTAGTTTGCTGGGG - Intergenic
935281934 2:101525920-101525942 GCAATTTTACTTTTGCGTAGAGG + Intergenic
935443610 2:103132704-103132726 GCAAGTTCACAAGTGTGCAGCGG + Intergenic
936252971 2:110882156-110882178 GTGATTCCAATAGTGTGTAGTGG + Intronic
939489224 2:142856873-142856895 GGAATTTCAGTAGGGTGCAGAGG + Intergenic
940100619 2:150034534-150034556 GCCATTTCACTAGTGAGAAAGGG + Intergenic
940534876 2:154928689-154928711 ACAGTTACACTGGTGTGTAGAGG - Intergenic
942348219 2:175025763-175025785 GCCATTCTACTAGTGTGCAGAGG + Intergenic
942542556 2:177029836-177029858 CCAATTTTAATATTGTGTAGTGG - Intergenic
943805833 2:192124558-192124580 GCAGTTTCACAACTGTATAGGGG - Intronic
946821305 2:223632746-223632768 GCAATTTCACAAATCTGTAAAGG - Intergenic
947410551 2:229834156-229834178 GTATTTTCACTTGTGTGTATTGG - Intronic
1171468013 20:25345738-25345760 GCCATTCTAATAGTGTGTAGTGG - Intronic
1173496368 20:43521616-43521638 GCAATTTCACTAGTGTGTAGAGG + Intronic
1181818461 22:25457474-25457496 GCAAGATCACCAGTGTGTACAGG - Intergenic
949938791 3:9137565-9137587 GCTAATTCCCTAGTGTGTTGGGG - Intronic
952841726 3:37652209-37652231 GAAGTTTCACTAGTGTGGTGGGG + Intronic
953473684 3:43188074-43188096 GCATTTTCAAGAGTGAGTAGAGG - Intergenic
955257450 3:57347851-57347873 GCCATTTTAATAGTGTTTAGTGG - Intronic
956389872 3:68760023-68760045 GCAATTTCAGAAGTGTGGAAAGG - Intronic
959816080 3:110674565-110674587 GCAATTAAAGCAGTGTGTAGAGG + Intergenic
960080384 3:113534191-113534213 GGAATTTCCCTAGAGGGTAGGGG - Intronic
962777057 3:138671715-138671737 GCAATTTTACTTCTGCGTAGAGG + Intronic
962973177 3:140424005-140424027 GCAATTTTACTTCTGTGCAGAGG - Intronic
967430332 3:189376744-189376766 GCATTCTAAATAGTGTGTAGTGG + Intergenic
970142702 4:12999472-12999494 GCTATATGACTAGTGTCTAGAGG - Intergenic
970692811 4:18639531-18639553 TCAATCTTACTAGTGTGTAGTGG + Intergenic
973869685 4:55153322-55153344 GCAGTGTTAATAGTGTGTAGAGG - Intergenic
975937061 4:79594461-79594483 GCAATTTCACTTGTTTAGAGGGG - Intergenic
978310325 4:107379951-107379973 GCAATTTTACTTCTGTGCAGAGG - Intergenic
983603200 4:169553792-169553814 CCAATTTAATCAGTGTGTAGTGG - Intronic
984421712 4:179531392-179531414 TAAATTACACTAGTGTTTAGGGG + Intergenic
984673129 4:182515114-182515136 GCAATTTCAGTAGTGTTCTGGGG + Intronic
987865308 5:23528599-23528621 GCAATTTTACTTCTGTGCAGAGG + Intergenic
1000103632 5:158038184-158038206 GCAATTTTACTTCTGTGCAGAGG + Intergenic
1000720866 5:164704842-164704864 GGAGTCTCACTAGGGTGTAGTGG + Intergenic
1005070902 6:21861447-21861469 GCAAATTCACTTGTCTGTTGAGG + Intergenic
1006856860 6:37139846-37139868 ACAATTTCAGTACTATGTAGAGG - Intergenic
1009325518 6:62344429-62344451 GCCATTTGACTAGTGTGAGGTGG - Intergenic
1011134302 6:84083168-84083190 GCAATTTTACTTTTGTGTAGAGG - Intronic
1012021660 6:93928948-93928970 GCAAGTGCACATGTGTGTAGAGG + Intergenic
1013282570 6:108652597-108652619 GCAATTTGTCTAGTGGGTGGTGG - Intronic
1014307836 6:119764857-119764879 GCAATTTTACTTCTGTGCAGAGG + Intergenic
1014395219 6:120919949-120919971 TCCATTTTAATAGTGTGTAGTGG - Intergenic
1014594776 6:123321549-123321571 GCAATTTCACAACTTTGTTGTGG + Intronic
1015031404 6:128600383-128600405 GGAATTTAACCAATGTGTAGAGG - Intergenic
1021834643 7:24657400-24657422 GCCATTCTAATAGTGTGTAGTGG + Intronic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1022516832 7:30980311-30980333 GCATGTTCACTAGAGTGCAGGGG - Intronic
1028325561 7:89520303-89520325 GCAATTTCATAAGTGTTTATAGG + Intergenic
1028468248 7:91176298-91176320 GCATTTAAAGTAGTGTGTAGAGG + Intronic
1034321003 7:150181817-150181839 TCAATTTCAGTATTTTGTAGGGG - Intergenic
1036035763 8:5017344-5017366 GCATTTTCAATAGTGTTTAATGG - Intergenic
1036584514 8:10110942-10110964 GCAATTTCTTTATTGTGGAGTGG + Intronic
1036783530 8:11669105-11669127 GTAATCTCACTACTGAGTAGTGG - Intergenic
1039179362 8:34847772-34847794 GTAATCTCACTGGTCTGTAGAGG + Intergenic
1043131456 8:76467679-76467701 GCAATTTGACTAGTGTGAGATGG + Intergenic
1043971337 8:86532184-86532206 GGAACTTCAGTATTGTGTAGAGG + Intronic
1047428549 8:124769060-124769082 GCAATTTCTCTAGCTTGTATTGG - Intergenic
1050197219 9:3098878-3098900 GCAATCTCACTAGTTATTAGGGG - Intergenic
1051415823 9:16839000-16839022 CTAATTTCACTAGTCAGTAGAGG + Intronic
1052473026 9:28924064-28924086 GCAATTCCACTTCTTTGTAGAGG - Intergenic
1062758971 9:138327319-138327341 ACAATTATAGTAGTGTGTAGAGG - Intergenic
1188131932 X:26446690-26446712 GCAATTTCAATAGAGTGATGAGG - Intergenic
1189372337 X:40438820-40438842 GCAATTTTACTTCTGTGTAGAGG + Intergenic
1189732187 X:44033231-44033253 GCAATTTAATTAGTGGCTAGAGG + Intergenic
1189935719 X:46066587-46066609 GCAATTTTACTTTCGTGTAGAGG + Intergenic
1190490480 X:50978152-50978174 GCAATTTTACTTCTGTGCAGAGG + Intergenic
1193023102 X:76813813-76813835 GCAATTTCACTGGAGTGTTGCGG - Intergenic
1196141074 X:112264227-112264249 GAAATTAGGCTAGTGTGTAGAGG + Intergenic
1201973140 Y:19817537-19817559 GCAATTTTACTTCTGTGCAGAGG + Intergenic