ID: 1173496948

View in Genome Browser
Species Human (GRCh38)
Location 20:43526352-43526374
Sequence GGCAAGAAGCAGCAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 466}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173496948 Original CRISPR GGCAAGAAGCAGCAGGATGA TGG Intronic
900165214 1:1241773-1241795 GCCAGGGAGCAGCAGCATGATGG + Intergenic
900338753 1:2177794-2177816 GCCAGGAAGAAGCAGGGTGATGG - Intronic
900495472 1:2974116-2974138 GGCAGAAGCCAGCAGGATGAGGG + Intergenic
900926487 1:5709420-5709442 GGCAAGAAGCAGCAAGAGAAGGG - Intergenic
901296055 1:8161720-8161742 GCCACGGAGCAGCAGGAGGAAGG - Intergenic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901825857 1:11860420-11860442 GTCAACAAGCAGCAGGCTGGAGG + Intergenic
901877581 1:12175633-12175655 GACAGGAAGGAGCAGGATTAGGG - Intronic
902216399 1:14936966-14936988 GGCAAGAACTAGCAAGGTGAAGG - Intronic
902860238 1:19239992-19240014 GGCAAGAAGGAGGAGGATTATGG + Intronic
902919044 1:19655778-19655800 GGCAGGAAGCAGGAGGAGGCTGG - Intronic
903018951 1:20380140-20380162 GCTAATAAGCAGCAGGGTGAGGG - Intergenic
903053134 1:20616401-20616423 GGCAGGAAGCAGGAGGAAGATGG - Intronic
903603631 1:24559387-24559409 GGCAGGAGGCGGCAGGAAGAAGG + Intronic
903842967 1:26257617-26257639 GACCAAAAGCAGCAGGATGGTGG - Exonic
904037595 1:27567175-27567197 GGCAGCAAGCAGCAGCATGCAGG - Intronic
905307218 1:37028083-37028105 GGCAAGAAGGAACAGGACTAAGG + Intronic
905343207 1:37293340-37293362 GGCCAGAAGGAGGGGGATGAAGG - Intergenic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906508007 1:46394322-46394344 GGTAGGCAGCAGCAGGCTGAAGG + Exonic
906511773 1:46414087-46414109 GGAAAGAAGCAGAAGAAGGAAGG - Intergenic
907321090 1:53602779-53602801 GCCAAGAGGCAGCAGGATGTGGG - Intronic
907578015 1:55546038-55546060 GGAAAGAAGATACAGGATGAGGG - Intergenic
907677769 1:56534525-56534547 GACTGCAAGCAGCAGGATGATGG + Intronic
907786824 1:57620691-57620713 GGCCAGCAGCAGCAGGAGTAGGG + Intronic
908001982 1:59689269-59689291 GCAGAGAAGCAGCAGGAAGAGGG + Intronic
908494072 1:64677254-64677276 GGCATGAAGCAGCAGGGCAAGGG + Intronic
908710202 1:67006193-67006215 GGGAAAAAGCTGCTGGATGAAGG - Intronic
910146386 1:84085521-84085543 CACAGGAAGCAGCAAGATGAGGG + Intronic
910229177 1:84968715-84968737 GACAAGAAGGAGCAGGTTAAAGG - Intronic
910321756 1:85954397-85954419 GCTAAGAGGAAGCAGGATGATGG + Intronic
911910191 1:103624361-103624383 GGGCAGAAGCAAAAGGATGATGG + Intronic
911913287 1:103663151-103663173 GGGTAGAAGCAAAAGGATGATGG + Intronic
911915167 1:103688796-103688818 GGGTAGAAGCAAAAGGATGATGG - Intronic
911917609 1:103718486-103718508 GGGCAGAAGCAAAAGGATGATGG + Intronic
911920700 1:103757289-103757311 GGGTAGAAGCAAAAGGATGATGG + Intronic
912434691 1:109653172-109653194 GGTCAGAAGTAACAGGATGAGGG - Intergenic
913029121 1:114880298-114880320 TGCCAGAAGCTGCAGGAAGAAGG - Intronic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
915015998 1:152734454-152734476 GGGAGGAAGAAGCAGGATAACGG - Intergenic
915082719 1:153363029-153363051 GGTAAGGAGCAGCAAGTTGATGG + Intergenic
915964981 1:160298684-160298706 GGCAAATAGCAACAGGAAGATGG + Intronic
916865182 1:168848819-168848841 TGCAGGAAGCTGCAGGAAGAAGG - Intergenic
917747691 1:178026619-178026641 AGCAAGATACAGCAGAATGATGG + Intergenic
919060560 1:192626958-192626980 GGCAAAGAGCTGCAGGATAAAGG + Intergenic
919503640 1:198370012-198370034 GGAAAGAAGCAACATGATGAAGG + Intergenic
920344782 1:205299152-205299174 GGCGAGAAGCTGAAGGGTGAGGG - Intergenic
920533902 1:206724738-206724760 GAGAAGAAGCAACAGAATGAGGG + Intronic
921119294 1:212123051-212123073 GAAAAGAAGCAGCAAGACGATGG - Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923626164 1:235615732-235615754 TCCAAGAAGCACCAGGAGGAGGG + Intronic
924058331 1:240145265-240145287 GGCAAGGAGCGGCGGGATGCCGG - Intronic
924634333 1:245771258-245771280 GGGAAAAAGAAGAAGGATGAGGG + Intronic
1063188360 10:3670304-3670326 GGAAAGGAACAGCAGGAAGAAGG - Intergenic
1064939366 10:20715305-20715327 AGCCAGAACCAGCAGAATGAAGG + Intergenic
1065975634 10:30839575-30839597 GGCAAAGAGAAGCAGGAGGACGG - Intronic
1066092945 10:32043905-32043927 GGCAAAGATCAGCAGAATGATGG - Intronic
1066206948 10:33198844-33198866 TGCAGGAAGCAGCAGGAAAAGGG + Intronic
1066993972 10:42545348-42545370 GGCCAGAGGCAGTAGGATAATGG + Intergenic
1067343114 10:45419863-45419885 GGGACGTAGCAGCAGGAGGAAGG + Intronic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1067923176 10:50480723-50480745 GGCCAGTGGCAGCAGGCTGAAGG + Intronic
1068684826 10:59859619-59859641 GGCACAAAGAAGCAAGATGATGG + Intronic
1068986972 10:63116628-63116650 GGAATGACGCAGAAGGATGATGG + Intergenic
1069900631 10:71704883-71704905 GGCAAGGAGGGGCAGCATGAGGG - Intronic
1070823378 10:79376048-79376070 AGCAGGAAGCAGCAGGAGGCAGG + Intergenic
1071797556 10:89022603-89022625 AGCAAGGAGCAGCAGGAGCAAGG - Intergenic
1072686883 10:97542769-97542791 GGCAAGAAGCAGGTGGCTCAGGG - Intronic
1073511125 10:104043203-104043225 GCCAATAAGCAGCAGGACAAAGG - Intronic
1073522156 10:104142753-104142775 GTCAAGAAGCAACAAGAGGAAGG + Intronic
1074238756 10:111614172-111614194 GGCAAGAAGCAAAGGGAAGATGG + Intergenic
1074737012 10:116445957-116445979 GGGAAGAAGGAGAAGAATGAAGG + Intronic
1074844922 10:117389241-117389263 TGCCATAAGCACCAGGATGAGGG - Intergenic
1075146950 10:119890600-119890622 TGGACCAAGCAGCAGGATGAGGG + Intronic
1075295076 10:121267948-121267970 TGCTAGAAGCAGGATGATGAAGG + Intergenic
1075601312 10:123771481-123771503 GGGAGGATGCAGCACGATGACGG + Intronic
1075999337 10:126903285-126903307 GGCCAGAAACAGGAGGAGGATGG + Intergenic
1076597138 10:131630858-131630880 GGCCAGTGGCAGCAGGAGGAGGG - Intergenic
1076904922 10:133356903-133356925 GGCACGGAGCAGCAGGGTGCAGG + Intronic
1077884986 11:6380751-6380773 GGCAAGAAGAGGCATGATCATGG + Intergenic
1078066038 11:8080314-8080336 AGCAAGGAGCAGCAGGCTGAGGG - Intronic
1078157077 11:8808262-8808284 AGCAGGACCCAGCAGGATGAGGG + Intronic
1078304288 11:10167688-10167710 GGCAAAAAGCAGCAGGAAACTGG + Intronic
1078453201 11:11455519-11455541 GCCAAGAAGAACCAGGATGCAGG + Intronic
1078464168 11:11538338-11538360 GGCAGGGAGCAGCTGGAGGAGGG + Intronic
1078475884 11:11629512-11629534 GGCAAGAAGCAGCTGGGAGATGG + Intergenic
1078478863 11:11658771-11658793 GGCAAGAAGCAGCTGCTTGCAGG + Intergenic
1078491628 11:11774848-11774870 GGCAAGAAGCAGGGGTCTGAAGG - Intergenic
1079089177 11:17468874-17468896 AGGCAGAAGCAACAGGATGATGG - Intronic
1079519053 11:21303008-21303030 GGCATGAAGCAGCATGATCATGG - Intronic
1079971404 11:27040354-27040376 GGCAAGAAGCAACAAGTTGCAGG + Intergenic
1080072063 11:28101035-28101057 GGCAAGAAGAAGCAGGAGTGGGG - Intronic
1081022798 11:37968355-37968377 GACGAGAAGCAGCTGGATGTCGG - Intergenic
1082634463 11:55579428-55579450 GGCAAGAAATAAAAGGATGAAGG + Intergenic
1083169291 11:60913371-60913393 GAGGAGAAGCAGCTGGATGAGGG - Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083573442 11:63772175-63772197 GGCAAGAAGGAGGAGGAGGAAGG + Intergenic
1083629858 11:64089840-64089862 GGAAAGAATGAGGAGGATGATGG + Intronic
1083655118 11:64225816-64225838 GGCAGGAAGCAGCAGGGTCCAGG - Exonic
1083812674 11:65114535-65114557 GGCAAGAAGAAACAGGCTGCGGG + Intronic
1083888114 11:65582498-65582520 AGAAAGAAGCAGCAAGATCAAGG + Exonic
1085027441 11:73244808-73244830 GGCAAAAAACAACAGGAAGAGGG + Intergenic
1085316637 11:75548993-75549015 AGCTAGAAGCAGAAGGATGCAGG + Intergenic
1085410343 11:76287147-76287169 GGCAAGAAGGAGCAGGTTCAAGG - Intergenic
1085456036 11:76665925-76665947 GGCCAGGAGCAGCAGGATCTGGG + Exonic
1085466037 11:76723948-76723970 GGTAAGAGGCACCAGGTTGAAGG - Intergenic
1086575759 11:88337622-88337644 GGAGAGAAGCAGCAGGAGGGCGG + Exonic
1086925584 11:92636989-92637011 GGCAAGTTGGAGGAGGATGAAGG - Intronic
1087081833 11:94178376-94178398 CGCAAAGAGCAGCAGGATGTAGG - Exonic
1088006156 11:104943034-104943056 TGCAAGAAGAATCATGATGAGGG - Intronic
1088925375 11:114296125-114296147 GGCAAGAACGAGAAGAATGATGG + Intronic
1089195277 11:116690764-116690786 GGCAGGAAGGAGAAGAATGAGGG + Intergenic
1089382894 11:118048901-118048923 GGCATGAGGCTGCAGGAGGAAGG - Intergenic
1089631833 11:119788850-119788872 GGGAAGAAGCAGCAGTTTGAGGG - Intergenic
1090171962 11:124613179-124613201 GGCAAGAGGGAGTAGAATGAAGG - Intronic
1091316697 11:134618892-134618914 TGCAGGAAGCAGCAGGATTAGGG + Intergenic
1091621605 12:2093328-2093350 GTCAAGAAGCATCAGGGTGCAGG - Intronic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1094056286 12:26272661-26272683 CACCAGAAGCAGCAGGATAATGG - Intronic
1095654143 12:44649380-44649402 GCCAAGTGGCAGCAGGTTGATGG - Intronic
1095923735 12:47557746-47557768 GGCATGAAGGAGCAGGGTGTTGG - Intergenic
1096226680 12:49870519-49870541 GCCAAAAAGCTGCAGGAAGAAGG + Exonic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101725973 12:107388505-107388527 GGAAAGAAGGAGGAGGAAGAGGG - Intronic
1101838523 12:108311698-108311720 GGCAAGAGGCAACAGGAGGAAGG + Intronic
1102425862 12:112843941-112843963 GGGAAGAAACAGCAGGCTGAGGG + Intronic
1102513260 12:113429629-113429651 GACAAGAAGTATCAAGATGATGG + Intronic
1102737859 12:115179158-115179180 GGCAAGAAGGAGAAGGGAGAAGG + Intergenic
1102915702 12:116750260-116750282 GGCCAGGAGGATCAGGATGAAGG - Exonic
1103452236 12:121037346-121037368 GGCATGAAACAGCTGGAGGAAGG + Intronic
1103553532 12:121752172-121752194 GGCACCCAGGAGCAGGATGATGG - Exonic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104422847 12:128651390-128651412 AGAAAGAAGCAGCAGGATCTTGG - Intronic
1104554432 12:129786985-129787007 GGCAAGTTGCAGAATGATGAGGG + Intronic
1104726385 12:131078079-131078101 GCCCTGAAGCAGCAGGAGGAGGG - Intronic
1104820298 12:131673139-131673161 TGGATGAAGCAGGAGGATGAAGG + Intergenic
1104947420 12:132422354-132422376 TGCGAGCAGCAGCAGGATGCTGG + Intergenic
1105533823 13:21245290-21245312 GCCAAGAAACAGCAGGAACAAGG - Intergenic
1106127492 13:26912338-26912360 GGAATGAAGCAGAAGGATGCAGG - Intergenic
1106766823 13:32921871-32921893 GGGAGGAAGCAGGAGGAAGAGGG + Intergenic
1107355568 13:39561965-39561987 GTCAATAATTAGCAGGATGAGGG + Intronic
1107449762 13:40497849-40497871 GGCCAGAGGCACCAGGAAGAGGG - Intergenic
1107458541 13:40578198-40578220 GCCAAGATGCAGCAGCATGCTGG + Intronic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1108745268 13:53387094-53387116 GGCAAGCAGCTGCAGAAAGAAGG - Intergenic
1109567616 13:64138168-64138190 GTTAAAAAGCAGAAGGATGAAGG + Intergenic
1109705597 13:66087388-66087410 GGCAAGTAGAAGCCGGAGGATGG - Intergenic
1110346197 13:74450553-74450575 GGCATGAGGCAGCAGAATGAGGG - Intergenic
1110386790 13:74921484-74921506 AGAAAGAAGCACCAAGATGAAGG + Intergenic
1112193273 13:97199129-97199151 GGCCAGAAACAGCAGGAGGCTGG - Intergenic
1112195688 13:97224113-97224135 GGCAAAAAGCAGCAGGGAGCAGG + Intronic
1112902250 13:104372135-104372157 GCCAAGAAACAGCATTATGATGG - Intergenic
1114516225 14:23301864-23301886 GGAAAGAAGAAGCGGGAGGAGGG + Intronic
1115095407 14:29630159-29630181 GGCAAGAAAGAGGAGGAGGAGGG - Intronic
1116151998 14:41153819-41153841 TGCACCAAGCAGCAGGATGTGGG - Intergenic
1116786904 14:49297705-49297727 CTCAAGAATCAGCAGGATAATGG + Intergenic
1117286148 14:54287521-54287543 GGCAGGAAGGAGGAGGAGGAAGG + Intergenic
1117338955 14:54777649-54777671 GGCAGGAGGGTGCAGGATGATGG + Intronic
1117756677 14:58981620-58981642 GGCAAGGAGCAGAAGAATCAAGG - Intergenic
1118256503 14:64210200-64210222 GGCACAAAGCAGCAGGTAGAAGG + Intronic
1119441198 14:74629941-74629963 GGCATGAAGGAGCAGCAGGATGG + Intergenic
1119722575 14:76901153-76901175 GGGAAGAAGCAGGAGGCAGAGGG + Intergenic
1120895429 14:89527098-89527120 GGAAAGGAGAAACAGGATGAGGG + Intronic
1122577275 14:102750313-102750335 AGCAAGAAGCAGCAGGGAGTGGG + Intergenic
1123117005 14:105899378-105899400 GGCAGGAAGCAGTAGCAGGAAGG + Intergenic
1124716161 15:32064313-32064335 AGCAAGAAGTAGAAGGATCAAGG - Intronic
1124997490 15:34737747-34737769 GGCTAGACTCAGCAGGATGGTGG + Intergenic
1125205377 15:37148616-37148638 GGCAGGAGGCAGAAGGATTATGG - Intergenic
1125889971 15:43258609-43258631 GGCGAGAAGCTGCAGGTTCATGG + Intronic
1125956403 15:43793639-43793661 GACAAGATGCAGGGGGATGAAGG - Exonic
1128304874 15:66591809-66591831 GCCAGGCAGCAGCAGGAAGAGGG - Intronic
1128400035 15:67269635-67269657 GGCAAGGAGGAGAGGGATGAGGG - Intronic
1128493492 15:68174467-68174489 GGCAAAAAGCAGGAGGAAAAGGG - Intronic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128836703 15:70814669-70814691 TGCAGGAAGCAGCAGGATGCTGG + Intergenic
1129296277 15:74602083-74602105 GGAAAGCAGCAGCAGGAGGGTGG - Intronic
1130101468 15:80897561-80897583 GGAAAGAAGCAGCAGCTTGTGGG + Intronic
1130172625 15:81531441-81531463 GGCACAGAGCAGCGGGATGAAGG - Intergenic
1130740430 15:86593152-86593174 AGGAAAAAGCAGCAGCATGAAGG - Intronic
1130931129 15:88428910-88428932 GGCAAGCAGCAGCAGGCTTCAGG + Intergenic
1131093662 15:89642264-89642286 GGCAAGGAGCTCCAGGATGCTGG - Exonic
1135140899 16:19921187-19921209 TGGAAGGAGCAGCAGGGTGAGGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137218788 16:46427232-46427254 GGCAAAAAGCAGCGGGAGGGGGG + Intergenic
1137218900 16:46427807-46427829 TGCAAAAAGCAGCAGGAACAGGG + Intergenic
1137440879 16:48497764-48497786 AGGAAGAAGCAGCAGCATGCAGG + Intergenic
1137977292 16:53042424-53042446 GGCAAGAAGAAAAAGGAGGAGGG - Intergenic
1137988865 16:53131695-53131717 GGAAAGAGGCTGCAGGATGGAGG - Intronic
1138184514 16:54966163-54966185 TGAAAGAAGGAGCAGAATGAAGG + Intergenic
1138229007 16:55324297-55324319 GGCAAGAGGGAGAAGGAGGAGGG - Exonic
1138346292 16:56322323-56322345 AGCAAGAAACAGCAGTGTGATGG + Intronic
1138968245 16:62111838-62111860 GGACTGAAGCAGCAGGATCATGG + Intergenic
1141495776 16:84408415-84408437 GCCCAGCAGCAGCAGGATCAGGG - Exonic
1141779587 16:86150762-86150784 GGCAAGGACCAGCTGGCTGATGG - Intergenic
1142810053 17:2391680-2391702 AGCAGGAAGCTGCAGGAAGAAGG - Intronic
1142944512 17:3413189-3413211 GGAGAGAAGCAGCAGGAGGGAGG + Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1145284738 17:21496892-21496914 GGTAAGAAGCAGCATGATTTTGG + Intergenic
1145304520 17:21666082-21666104 GGCAAAAACCAAGAGGATGAGGG - Intergenic
1145327580 17:21843888-21843910 GGCAAAAAGCAGCGGGAGCAGGG - Intergenic
1145392782 17:22468871-22468893 GGTAAGAAGCAGCATGATTTTGG - Intergenic
1145746881 17:27326523-27326545 GGCAAGAGGCAGGAGGAGCAGGG + Intergenic
1145787657 17:27604515-27604537 GGCAATAGGCAGGAGGCTGAGGG - Intronic
1145867836 17:28252047-28252069 AGCAAGAAAAAGCAAGATGAAGG - Intergenic
1145886883 17:28388143-28388165 GGCAATAGGCAGCATGGTGAAGG - Intronic
1146063969 17:29621227-29621249 GGCCAGAGGCAGGACGATGAAGG + Exonic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147513429 17:41093836-41093858 GGCAAGAAGCAGCTGGATGTTGG + Intronic
1147515517 17:41114130-41114152 GGCAAGAAGCAGCTGGACATTGG + Intergenic
1147917981 17:43900115-43900137 GGCAGGGAGCAGGAGGAGGAAGG - Intronic
1148091239 17:45023662-45023684 GGCCAGGAGCAGCAGGTTGAAGG + Exonic
1148816105 17:50329295-50329317 GGCCAGAAGCTGAAGGATGTGGG - Intergenic
1150135493 17:62692895-62692917 GGCGAGAGGGAGCAGGGTGAGGG - Exonic
1151567329 17:74906386-74906408 TGGAACAAGCAGCAGGATGTGGG - Intergenic
1151568635 17:74915019-74915041 AACCAGAGGCAGCAGGATGAGGG - Intergenic
1152003492 17:77662205-77662227 AGAAGGAAGGAGCAGGATGAAGG - Intergenic
1203192284 17_KI270729v1_random:200373-200395 GGCAAAAAGCAGCGGGAGCAGGG - Intergenic
1153230261 18:2928244-2928266 GGGAAGAAGCAGCAAGAAGAAGG - Intronic
1153698531 18:7668630-7668652 GGCAGGAGGCAGCTGCATGAGGG - Intronic
1153810059 18:8744536-8744558 CACAAGAAGCAGCAGGAAGCAGG - Intronic
1153836595 18:8969497-8969519 GGCAGGAGGCAGCTGGATGGAGG + Intergenic
1153939842 18:9968361-9968383 GGCAAGAAGCAGCTGGGTTCTGG - Intergenic
1155099584 18:22596145-22596167 GGCAAGAAGCAGCAAGAAGTGGG - Intergenic
1155185569 18:23383874-23383896 TCCAAGGAGCGGCAGGATGATGG + Intronic
1155328112 18:24686389-24686411 TGCAAGAAGCAGCAGGTGCAGGG + Intergenic
1155759009 18:29540889-29540911 GGCAAAAAAAAGAAGGATGAGGG + Intergenic
1156017496 18:32563145-32563167 AGCAAGAACCAGTAGGAGGAAGG + Intergenic
1157711882 18:49855843-49855865 GGCAAGGAGAAGCAGCATGAGGG + Intronic
1158118858 18:54026177-54026199 GGAAAGGGGCAGCAGGATGTGGG + Intergenic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159553101 18:69917406-69917428 GGCAGAAAGCAGCAGAAGGAGGG - Intronic
1161415644 19:4145196-4145218 GGCAAGAGGGAGGAGGAGGAAGG + Intergenic
1162836829 19:13325154-13325176 GGAAAGAAGAAGAAGGAAGAAGG - Intronic
1162901135 19:13795960-13795982 GGACAGAAACAGGAGGATGAGGG - Intronic
1163715684 19:18870764-18870786 GGCAAGGAGGGGCAGGGTGAAGG - Intronic
1164859441 19:31551238-31551260 GGAGAGAAGGAGGAGGATGAGGG - Intergenic
1165986563 19:39774484-39774506 GGGAAAAGGCAGGAGGATGAGGG + Intergenic
1167286675 19:48602309-48602331 GGAAGGCAGCAGCAGGAGGAGGG + Intronic
1167572815 19:50300270-50300292 GACAGGAAGCAGCAGGGTCATGG + Intronic
1168328248 19:55549781-55549803 GGCATGAAGCAGCAGAGTCATGG + Intergenic
926218119 2:10917892-10917914 GGGCAGAAGCAACAGGCTGATGG + Intergenic
927128530 2:20036270-20036292 GGCAAGAAGCAGCATAGTGAGGG - Intronic
927822382 2:26279258-26279280 GCCAAGAAGGCACAGGATGAAGG + Exonic
927866204 2:26589262-26589284 GGAAAGAAGGAGGAGGAGGAAGG - Intronic
928646558 2:33359175-33359197 GGCCAGAATCAACTGGATGAGGG + Intronic
929073541 2:38058358-38058380 TGCAGGAAGAAGCAGCATGAGGG + Intronic
929118601 2:38465488-38465510 GGCAAGAAGTGGCAGGATGTCGG - Intergenic
929401691 2:41590217-41590239 GACAAGAAGCACCAGAAGGAAGG + Intergenic
929457939 2:42079296-42079318 GGCAAGAAGAATCAAGATGGCGG - Intergenic
930087780 2:47510135-47510157 AGCAAGAAGTAGCAGGGAGAAGG - Intronic
931213464 2:60219676-60219698 GGTCAGAAGCAGCACGATGTTGG + Intergenic
931328872 2:61258580-61258602 GCAATGAAGCAGCAGGGTGATGG + Intronic
931635510 2:64337713-64337735 GCCAAGAAGCAACAGGAGGTGGG + Intergenic
932679992 2:73816635-73816657 GCCTAGAAGCAGCAGATTGAGGG - Exonic
933158195 2:78996936-78996958 AGAAAGGAGCAGCAGGCTGAAGG - Intergenic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933427230 2:82128657-82128679 GGCAACTAGAAGTAGGATGAGGG - Intergenic
933479829 2:82841606-82841628 TACAAGAAGCAGCAACATGAAGG - Intergenic
934331625 2:92074275-92074297 GGCAAAAAGCAGCAGGAGCGGGG - Intergenic
934951439 2:98578399-98578421 GGCAGCAAGGAGCAGGATCAGGG + Intronic
935646004 2:105335299-105335321 GGAAAAAAGTGGCAGGATGATGG - Intergenic
937079424 2:119129658-119129680 AGCAGGATGAAGCAGGATGAAGG - Intergenic
938070057 2:128303628-128303650 GTCATGAAGCAGAAGGATGTTGG - Intronic
938747072 2:134289398-134289420 GGCAGGAAGCAGCTGGCTGATGG - Intronic
938954029 2:136282188-136282210 GGGAAGAAGGAGGAAGATGAAGG + Intergenic
939014627 2:136887578-136887600 GGCAAGAGGGAGCAAGATGGGGG - Intronic
940070616 2:149683325-149683347 GGCAAGAAACAGGTCGATGAAGG - Intergenic
940101800 2:150048627-150048649 GGCAAGAAGGAGAAGGGAGATGG + Intergenic
940532934 2:154903625-154903647 GGCAGGAAGGAGAAGAATGAGGG + Intergenic
942043739 2:172087249-172087271 GGTAAGAAGGAGGAGGAGGAGGG - Intronic
942078807 2:172381518-172381540 GGCAAGATGCAGATGGATGAAGG - Intergenic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
943175764 2:184472049-184472071 AGTAAGAAGGAGGAGGATGAAGG + Intergenic
943834366 2:192500424-192500446 GAGGAGAAGCAGCTGGATGATGG + Intergenic
943860248 2:192853051-192853073 GGCAGAACACAGCAGGATGATGG - Intergenic
944160770 2:196656915-196656937 GGCATCAAGCAGCAGAAAGAAGG - Intronic
945538138 2:211046311-211046333 GGCAATAAGCAGAAGCAAGAAGG + Intergenic
945552287 2:211235311-211235333 GGCACCAAGCAGAAGTATGAAGG + Intergenic
946107413 2:217383737-217383759 TGGAATAACCAGCAGGATGACGG + Intronic
946253965 2:218430072-218430094 GGCTGGGAGGAGCAGGATGAGGG + Intronic
947731332 2:232433169-232433191 GGCAGTCAGGAGCAGGATGATGG + Intergenic
1168774707 20:438180-438202 GGCAAGCAGGAGCAGTAAGAGGG + Exonic
1169777315 20:9269885-9269907 GGGCAGTAGCAGCAGGAAGATGG + Intronic
1170063589 20:12286477-12286499 GGCAAGAAGGAGCTGGAGGTGGG + Intergenic
1171126409 20:22605731-22605753 GGCAGGTAGCAGCACCATGAAGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172790601 20:37502892-37502914 GGAAAGAAGCAGCAAGATCCAGG - Intronic
1173001466 20:39108868-39108890 GGCAAGAAGACTCAGAATGAAGG + Intergenic
1173314031 20:41927562-41927584 TTCAGGAAGCAGCAGGCTGATGG - Intergenic
1173496948 20:43526352-43526374 GGCAAGAAGCAGCAGGATGATGG + Intronic
1173500387 20:43548749-43548771 GAAACGAAGCAGCAGAATGAGGG - Intronic
1173789147 20:45816314-45816336 GGCAAGAGGCAGCTGGACCAGGG - Intronic
1173817165 20:45997190-45997212 GGCAATAAGGAGCTGGATGCTGG + Intergenic
1173970663 20:47149905-47149927 GGCAAGATGCAGCAGGACTGAGG + Intronic
1174246618 20:49187193-49187215 GACAAGAAGAAGCTGGATGATGG + Intronic
1174317696 20:49715121-49715143 GGCAAGAAGCAGTAGCCTCAAGG + Intergenic
1174444726 20:50582889-50582911 GGCAAAAAGTAAAAGGATGAGGG - Exonic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1176095022 20:63337149-63337171 GGAAAGAAACAGCAAGAGGAGGG + Intergenic
1176292983 21:5056034-5056056 GGCAAGCAGCCCCAGGCTGAGGG - Intergenic
1178511935 21:33212668-33212690 AACAAGAAGCAGCATGCTGAGGG - Intergenic
1178675882 21:34631372-34631394 GGCAAGAAGCAGGGAGGTGATGG + Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1179864277 21:44207616-44207638 GGCAAGCAGCCCCAGGCTGAGGG + Intergenic
1180048057 21:45318746-45318768 GGCAGGAAGGGGCAGGATGGGGG - Intergenic
1180117866 21:45724005-45724027 GCCAACAAGAAGCAGGATGTGGG - Intronic
1181167379 22:20991033-20991055 GGCAGGGAGCCCCAGGATGAGGG + Intronic
1181947246 22:26527917-26527939 GGCAGGAAGCACCACTATGATGG - Intronic
1183299545 22:37052076-37052098 GGGAAGAAGCGGCAGGAGGAGGG + Intronic
1183466647 22:37983603-37983625 GTCAAGAAGGAGCAGCAGGACGG - Exonic
1183524134 22:38313922-38313944 GGAAGGAAGCAGCAGGTTGCCGG - Intronic
949869922 3:8579879-8579901 TGCAAGAATCAGCAGGAAGAGGG + Intergenic
950035132 3:9879787-9879809 GGCTAGGAAGAGCAGGATGAAGG - Intronic
950624052 3:14231316-14231338 GGAAAAAAGCAGGAGGATCAGGG - Intergenic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
952244788 3:31575624-31575646 GTCAAGAAGCAGAACGATGCTGG - Intronic
953208716 3:40855269-40855291 GGTAAGAAGCTCCAAGATGAGGG - Intergenic
953216346 3:40922390-40922412 GGCAGGAAACTGCAGGATGAGGG - Intergenic
953569734 3:44062025-44062047 GGCAGGAACCAGCAGTTTGAAGG - Intergenic
954644899 3:52125265-52125287 TGAAAGCAGCAGCAGGATAAAGG + Intronic
954960979 3:54564754-54564776 CACAAGAAGGAGCTGGATGAGGG - Intronic
955649936 3:61183122-61183144 GGCAAGAAGCAACAGAATTCAGG - Intronic
955705105 3:61719645-61719667 GGGAGGAAGAAACAGGATGAAGG - Intronic
956486592 3:69729408-69729430 GGCAAGATGGTGCAGGATGTTGG + Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
958665375 3:97129730-97129752 GGCAAGGAGCAGCAGGGTTGGGG + Intronic
959147883 3:102571606-102571628 GGCATGGAGCAGCAGCCTGAGGG + Intergenic
959583197 3:108002677-108002699 GGAAAGAAGCTACAGAATGAAGG - Intergenic
959664413 3:108905145-108905167 GGCATGAGGCAGCAGAGTGACGG + Intergenic
960995444 3:123337267-123337289 GGAAACAAGCAGCTGAATGACGG + Intronic
961831995 3:129627615-129627637 GGCAAGAAGCAGCGGGGTGGAGG + Intergenic
961904513 3:130248715-130248737 GATAAGAAGCAGCAAGATGTAGG - Intergenic
962102034 3:132352773-132352795 GGCAAGAAGCATAGGGAGGAAGG - Exonic
963248249 3:143082749-143082771 GCCAAGGAGGAGGAGGATGAAGG - Intergenic
963561889 3:146876094-146876116 GGGAAGAAGCAGCAGGGGCAGGG + Intergenic
963587673 3:147213685-147213707 GGCAAGAAGGAGGAGGTTTACGG + Intergenic
963973932 3:151460086-151460108 AGGAAGGAACAGCAGGATGAAGG + Intergenic
964093993 3:152910425-152910447 GGCAGGAAGCAGAAGGTAGAAGG + Intergenic
964159594 3:153630908-153630930 GGGTAGAAGCAGCAGGGAGAGGG + Intergenic
964940222 3:162151276-162151298 GGGAGGGAGGAGCAGGATGAGGG - Intergenic
965156087 3:165057574-165057596 GGCAAAAAGCAGCAGGATAAAGG + Intronic
965435475 3:168645336-168645358 GGCCAGAAGCTGGAGGAAGATGG + Intergenic
965550461 3:169959780-169959802 GGGCAGCAGCAGCAGGAAGATGG - Intergenic
965619989 3:170633700-170633722 GGCAGAGAGCAGCAGGTTGAGGG - Intronic
965882322 3:173400617-173400639 GGAAGGAAGCATCATGATGAAGG - Intronic
966258938 3:177952077-177952099 GGCAAGGAGAAGAAAGATGATGG - Intergenic
966872385 3:184299354-184299376 GGCAAGGAGCGGCGGGATGCCGG + Exonic
967205194 3:187113096-187113118 GGGAGGAGGCAGCAGGGTGAAGG + Intergenic
967259066 3:187624046-187624068 GGCAACAAGGAGCATGGTGAGGG - Intergenic
967312546 3:188119782-188119804 AGCAAGGGGCAGCAGGATGTTGG - Intergenic
967859867 3:194142262-194142284 GGTTAGAAGCAGAAGGGTGAGGG + Intergenic
967917187 3:194587489-194587511 GGCAAGTTCCAGCAGCATGAAGG - Intergenic
969695153 4:8729986-8730008 GGCAGGTCTCAGCAGGATGACGG + Intergenic
970124844 4:12797661-12797683 GCCAAGAAGCTGCAGGAGCAGGG + Intergenic
971004461 4:22357648-22357670 GGCAAGCCGAAGCAGGGTGAGGG + Intronic
971169071 4:24214713-24214735 GGCAAGAAGCAGGAGTGTTAAGG + Intergenic
971387988 4:26159139-26159161 GGCAAAAAGAAACAGGAAGAAGG + Intergenic
971405725 4:26319915-26319937 GGCATGGAACAGCAGGGTGAAGG - Intronic
971753743 4:30682124-30682146 GGGTAGAAGCAGCAGAATAAAGG + Intergenic
972156783 4:36172889-36172911 AGAAAGGAGCAGCAGGATGGAGG - Intronic
972423247 4:38909915-38909937 TTCAAGGAGCAGCAGGGTGATGG - Intronic
972967481 4:44529349-44529371 GGAAGGAGGAAGCAGGATGAAGG - Intergenic
976184178 4:82429248-82429270 AGCAAGAATCAGCAGGATGACGG - Exonic
976401263 4:84609506-84609528 TACAAGAAGCATCAGCATGAAGG - Exonic
976425019 4:84893189-84893211 GGCAAGAAGCAGCAGAATAGAGG - Intronic
977081003 4:92527478-92527500 GGGAAGAAGTAGCAGGAAAAGGG + Intronic
977984292 4:103363571-103363593 GGTAAGAAGTAGCAGGGGGAAGG - Intergenic
978194461 4:105954633-105954655 AGCAAGAAGGTGCAGGAGGAAGG - Intronic
979922595 4:126519180-126519202 GGCAGGATGGAGCAGGATGGTGG + Intergenic
980492951 4:133552949-133552971 GAGCAGAAGCAGCAGGATGTTGG - Intergenic
980640122 4:135566209-135566231 GGCAAGAAGCAGCAGCTTCCAGG + Intergenic
980722137 4:136712161-136712183 GGCAACACACAGCAGGAAGAAGG - Intergenic
981608205 4:146563096-146563118 GCCAGGTAGCAGCAGGCTGATGG - Intergenic
981643205 4:146968386-146968408 AGCAAGAAGCAGAAGAATGCAGG + Intergenic
983172341 4:164550097-164550119 GGAAGGCAGCAGCAGGATGTTGG - Intergenic
983340829 4:166458769-166458791 GGCAGGGAGAGGCAGGATGAAGG - Intergenic
985117267 4:186604773-186604795 GGGAAGAAAAAGGAGGATGAAGG + Intronic
986376736 5:7139848-7139870 GGCAGAAAGCAGCAAGCTGAAGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987445397 5:18011510-18011532 GGAAAGAAGCAGCATGAAGAAGG + Intergenic
987452463 5:18103254-18103276 GGCAAGAAGAAACATGAAGATGG + Intergenic
987953257 5:24703589-24703611 GGCAAGGAGCAGAAGGAGGTAGG - Intergenic
990258617 5:53997644-53997666 GGCATCCAGGAGCAGGATGAAGG + Intronic
990519090 5:56560467-56560489 GGCCTGAAGTAGCAGGCTGATGG - Intronic
990564106 5:57011852-57011874 GGCAAGAATCAGCAGGACAGAGG - Intergenic
991390997 5:66143792-66143814 GGAAAGAGGCAGTAAGATGAAGG - Intronic
994913510 5:105943782-105943804 GCGAAGAAGCAGCTGGATGTTGG - Intergenic
995103386 5:108344082-108344104 AGTAAGAAACAGCAGGATCAAGG + Intronic
995614828 5:113950197-113950219 GGCTGGGAGCAGCAGAATGAGGG - Intergenic
996016688 5:118546929-118546951 GGCAAGAAGTAGCAGGGAGCAGG + Intergenic
996315754 5:122158876-122158898 GGGAAGAAGCTGGAGAATGAAGG + Intronic
996593976 5:125180219-125180241 TGCCTGAAGCAGCAGGATGATGG + Intergenic
997091162 5:130860272-130860294 GTCAAGCAGCAGTAGGATGAGGG - Intergenic
997441098 5:133909077-133909099 TGCAGGAAGGAGAAGGATGAGGG + Intergenic
998450626 5:142231844-142231866 GGCAAGAAGGGGCAAGAAGAGGG - Intergenic
999263423 5:150251548-150251570 GGCAAGAAGCAGCACCAAAATGG - Intronic
999938298 5:156512759-156512781 GGAAGGATGCAGCAGGATGGGGG - Intronic
1000435353 5:161201108-161201130 GTCAAGAAGCAGGAGGATGCAGG + Intergenic
1001320724 5:170678837-170678859 GGAAGGAAGCAGCAGGGAGAGGG + Intronic
1001484569 5:172110600-172110622 GGCAGGAAACAGCAGGCTGGAGG + Intronic
1002600320 5:180350821-180350843 TGAGAGAAGCAGCAGGATAAAGG + Intronic
1003264265 6:4551682-4551704 GGCAAGGATCAGCAGGAAGTGGG + Intergenic
1004343424 6:14827314-14827336 AGCAAGAAAGAGCAGGAAGAAGG + Intergenic
1005115360 6:22329912-22329934 GGCAAGATAGTGCAGGATGATGG - Intergenic
1005333983 6:24775120-24775142 GGCAAGAGGCGGCAGGAAGTGGG + Exonic
1005493013 6:26364073-26364095 GGCAAGAGGAAGAAGGAAGAAGG + Intergenic
1005840266 6:29740614-29740636 GCCTAGAAGCAAGAGGATGAAGG - Intergenic
1006174997 6:32116346-32116368 GGTGAGAAGCAGCAGGAAGTAGG - Intronic
1006460399 6:34154662-34154684 GACAAAAAGCAGCAGCAGGAGGG + Intronic
1007633864 6:43286652-43286674 GGCAAGAAGGAACAGGCTGAAGG - Exonic
1007734198 6:43970549-43970571 GGCTGGAAGTAGCAGGAGGAGGG - Intergenic
1008063663 6:47025333-47025355 GGCCAGCAGCAGCAGCATTAGGG - Intronic
1008592709 6:53010055-53010077 GGGAAGAAGGAGAAGGATAAAGG - Intronic
1009976707 6:70678795-70678817 GGCAAGGAGGAGCAGAATCAAGG - Intronic
1011000454 6:82582699-82582721 GTAAAGAAGCAGCAGGAAGGTGG + Intergenic
1012038793 6:94177298-94177320 GGCAAAAAGCAGCAAGATACTGG - Intergenic
1012468609 6:99544219-99544241 GGCCTGAAGCTGCAAGATGATGG - Intronic
1013990559 6:116250670-116250692 GGAAAGAACCTGCAGGATCAGGG - Exonic
1014704987 6:124734951-124734973 GGCAAGAAGAATAAGGATGAAGG - Intronic
1015810829 6:137160586-137160608 GGCCAGAAGGAGGAGGAGGAGGG - Intronic
1017993093 6:159506899-159506921 GACAAGAAGGGGCAGGAAGATGG - Intergenic
1018167838 6:161116186-161116208 GGAAAGAAGCAGCTGGGTGAGGG + Intronic
1018363413 6:163095581-163095603 AGCTAGAAGCAGCAGGAAGGAGG - Intronic
1018480526 6:164184862-164184884 AGCAAGAACCAGCATGATGGGGG - Intergenic
1018560413 6:165096611-165096633 GACAAGAAGCCTCAGAATGACGG - Intergenic
1018790077 6:167141635-167141657 GACAACAAGAAGCAGGATGCGGG + Intergenic
1018996602 6:168715028-168715050 GGGGAGAAGGAGGAGGATGATGG + Intergenic
1020026719 7:4904847-4904869 TGCAAGTAGCTGCATGATGAAGG + Intergenic
1021100841 7:16585066-16585088 GGAAAGGAGAAGGAGGATGATGG - Intergenic
1021258726 7:18427560-18427582 GGCCAGGATCAGCAGGATTATGG - Intronic
1021594514 7:22300891-22300913 GGCAAGAAGAATCAGGAAAATGG - Intronic
1023520254 7:41043274-41043296 GGAAAGAAACAGCAGTATGCTGG - Intergenic
1023522145 7:41059457-41059479 TGAAAGAAACAGCAGGTTGAGGG + Intergenic
1023966403 7:44965172-44965194 GGCAGGCAGCACCAGGCTGAGGG - Intronic
1023967542 7:44970755-44970777 GGCCAGAGGCAGCAGGAAGCAGG - Intronic
1024219502 7:47276874-47276896 GGCAAGGAGCAGCACAAAGAGGG + Exonic
1024570095 7:50716122-50716144 GGGAAGAACCACCAGAATGAAGG + Intronic
1024674575 7:51626720-51626742 GGGAAGCAGCAGCAGGAGGGAGG - Intergenic
1025282531 7:57638696-57638718 GGCAAAAACCACGAGGATGAGGG - Intergenic
1025900536 7:65740833-65740855 GGAAAGAAGCAGAAGGAAGCCGG + Intergenic
1025994325 7:66518604-66518626 GGACAGAGGCAGCAGGAGGAGGG - Intergenic
1026165609 7:67906486-67906508 GGCAAGAAACAGCATGTTCAGGG + Intergenic
1026400442 7:70006553-70006575 TGCAAGAAGTAGCAAGATGTTGG - Intronic
1026682096 7:72474783-72474805 GGCAAGAGGCAGGAGGGAGACGG - Intergenic
1026985935 7:74555293-74555315 GGACAGAGGCAGCAGGAGGAGGG - Intronic
1029449746 7:100634109-100634131 GGGAAGAACCTACAGGATGATGG - Intronic
1029477341 7:100792748-100792770 GGCAGGAAGGAGCGGGATGCGGG - Intronic
1029507135 7:100969236-100969258 GCCAAGAAGCACCAGGAAGCGGG - Intergenic
1029672087 7:102040331-102040353 GGGAAAGAGCAGCAGGAAGATGG + Intronic
1029939769 7:104467829-104467851 GAGAAGGAGGAGCAGGATGAAGG - Intronic
1031556052 7:123177780-123177802 GAAAAGATGCAACAGGATGATGG - Intronic
1032172954 7:129600942-129600964 TTCAAGAGGCAGCAGGATGAAGG - Intergenic
1033244222 7:139704861-139704883 GGCCAGAAGCAGCAGCCTGGAGG + Intronic
1033573437 7:142656714-142656736 GGCATGAAGAGGCAGGATGGAGG - Intergenic
1034012674 7:147546951-147546973 GGCAAGAAGCAAGAGGAACAGGG + Intronic
1034033130 7:147789704-147789726 GGCAAGAAAAAGCAGGCGGAAGG + Intronic
1035014311 7:155751519-155751541 GGCAAGAAACAGCAGATTTAGGG - Intronic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035352915 7:158259000-158259022 GGCAGGAAGCAGGAGCAGGACGG + Intronic
1035475395 7:159140475-159140497 GGAGAGAAGCAGCAGCATGCCGG - Intronic
1037468229 8:19181946-19181968 GGCAAGAAGAAGAAGGATGGAGG + Intergenic
1037806436 8:22060162-22060184 GGCGAGCTGCAGCAGGAAGAGGG - Intronic
1038024656 8:23577804-23577826 GCCAAGAAGGAGCAGGACTAAGG - Intergenic
1038406677 8:27327122-27327144 GGCTAAAAGCAGCAGGAGGCTGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038486242 8:27937254-27937276 GGCAGGAAGCAGGAGGTTGGAGG - Intronic
1039593131 8:38767576-38767598 GGCAAGAAGCAGGAAGGAGATGG - Intronic
1041441776 8:57904792-57904814 GGGAAGAAGCAAGAGGAAGAGGG + Intergenic
1041462743 8:58129777-58129799 AGAAAGAAGGAGCAGGATGCGGG - Intronic
1043477213 8:80616894-80616916 GGCAGCAAGCAGCAGGCTGGTGG - Intergenic
1044917776 8:97134345-97134367 AAAAAGAAGCAGCAGCATGAAGG + Intronic
1045324348 8:101106602-101106624 AGAGTGAAGCAGCAGGATGAAGG + Intergenic
1047192983 8:122695464-122695486 GCCAGGGAGCAGGAGGATGAGGG + Intergenic
1047572596 8:126116417-126116439 GTCAAAAATCAGCAGGCTGAGGG - Intergenic
1048836322 8:138522313-138522335 GACCAGGAGCAGCAGGATGTGGG + Intergenic
1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG + Intronic
1050829094 9:9989415-9989437 GAGAAGAAGCAGCTGGATGTTGG + Intronic
1052195203 9:25704146-25704168 AGCAAGAAGTAACAGGAAGAGGG + Intergenic
1053450326 9:38188545-38188567 GGAAGGAGGCAGCAGGAAGAAGG + Intergenic
1053946144 9:43311756-43311778 GGCAAAAAGCAGCAGGAGCGGGG - Intergenic
1055621871 9:78134384-78134406 GGAAAGATGCAGATGGATGAAGG - Intergenic
1056018420 9:82416587-82416609 GGTAGGAAGCAGCAGCAGGAAGG + Intergenic
1057219340 9:93247654-93247676 CCCAAGGAGCAGCAGGATGTGGG + Exonic
1057276442 9:93678240-93678262 GGCAGGTGGCAGCAGGATGGTGG + Exonic
1057513061 9:95697017-95697039 TGCAAAAAGCAGCAGGTGGAGGG + Intergenic
1057576661 9:96247599-96247621 GGGAAGAAGAGGGAGGATGAGGG + Intronic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1059739528 9:117136027-117136049 AGCAAGAACCAATAGGATGAAGG - Intronic
1060202708 9:121661054-121661076 GTGAAGAAGCGGGAGGATGAGGG + Intronic
1203589274 Un_KI270747v1:40314-40336 GGCAAAAAGCAGCAGGAGCGGGG - Intergenic
1186025493 X:5306348-5306370 GCCAAGAAGGCACAGGATGAAGG - Intergenic
1186225585 X:7395867-7395889 AGCAAGAAGAAGAAGGAGGAAGG - Intergenic
1187025741 X:15433909-15433931 GGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187660310 X:21538887-21538909 GGCTAGAAACAGCAGGCAGAAGG - Intronic
1188243597 X:27816412-27816434 GACAAGAATCAGGAGAATGATGG - Intronic
1189337949 X:40182209-40182231 GCCAGGAAGCAGCAGGAGGTAGG - Intergenic
1189546440 X:42047093-42047115 GACAAGAAGCAGCAGCAAGAAGG - Intergenic
1193048170 X:77075149-77075171 ACCAAATAGCAGCAGGATGATGG - Intergenic
1193404401 X:81083784-81083806 GGCAAGCAGAAGCAGGGTGGGGG + Intergenic
1193422329 X:81296194-81296216 GACAAGCAGCAGTAGGAGGATGG + Intronic
1196194159 X:112822642-112822664 GGAAAGATGCACCAAGATGAGGG - Exonic
1196212439 X:113010958-113010980 GGCAGGAGGCAGCAGGGTTATGG - Intergenic
1196805706 X:119583812-119583834 GGCAAGAAGGAGAAAGTTGAAGG + Exonic
1197598378 X:128495246-128495268 GGCTAGAAAAAGCAGGCTGAAGG + Intergenic
1197685082 X:129430462-129430484 GGCAAGAAACAGAAGGAAGGGGG - Intergenic
1199685455 X:150261134-150261156 GCCAAAAACCAGCAGGAAGATGG + Intergenic
1199759555 X:150894889-150894911 GTCAAGAATAAGCATGATGAGGG - Intronic
1200133542 X:153863932-153863954 GACGAGGAGCAGGAGGATGATGG + Exonic
1200693877 Y:6338863-6338885 GGCAAGAAGCAGTAGTTGGATGG + Intergenic
1201041400 Y:9835856-9835878 GGCAAGAAGCAGTAGTTGGATGG - Intergenic
1201625542 Y:16010952-16010974 GGAAAGAAAGAGCAGGAAGAGGG + Intergenic