ID: 1173497068 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:43527435-43527457 |
Sequence | TCCACCTCAGGTTAGATTGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173497063_1173497068 | 15 | Left | 1173497063 | 20:43527397-43527419 | CCTTTAAAGGGTGTTTGTCCTCT | No data | ||
Right | 1173497068 | 20:43527435-43527457 | TCCACCTCAGGTTAGATTGAAGG | No data | ||||
1173497066_1173497068 | -3 | Left | 1173497066 | 20:43527415-43527437 | CCTCTGTTAGAGGCTAGGACTCC | No data | ||
Right | 1173497068 | 20:43527435-43527457 | TCCACCTCAGGTTAGATTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173497068 | Original CRISPR | TCCACCTCAGGTTAGATTGA AGG | Intronic | ||