ID: 1173497068

View in Genome Browser
Species Human (GRCh38)
Location 20:43527435-43527457
Sequence TCCACCTCAGGTTAGATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173497063_1173497068 15 Left 1173497063 20:43527397-43527419 CCTTTAAAGGGTGTTTGTCCTCT 0: 1
1: 0
2: 1
3: 17
4: 137
Right 1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1173497066_1173497068 -3 Left 1173497066 20:43527415-43527437 CCTCTGTTAGAGGCTAGGACTCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173497068 Original CRISPR TCCACCTCAGGTTAGATTGA AGG Intronic
902240188 1:15083252-15083274 TCAACCTCAGGCTAGGTGGAGGG + Intronic
902282324 1:15383617-15383639 TCCACCTTAGGCAAGAGTGAAGG - Intronic
903032440 1:20473523-20473545 TCCACCTCAGCTAGGATTGCAGG + Intergenic
903525155 1:23987657-23987679 TCCACCTCCTGTCAGATTGGTGG - Intergenic
904353088 1:29921679-29921701 TCCACCTCCTGTTAGATCAATGG - Intergenic
904435357 1:30491497-30491519 TCCACCTCCTGTCAGATTAATGG - Intergenic
905434849 1:37949181-37949203 TCCAGCTCAGGTTACATTGCAGG - Intergenic
906089870 1:43169828-43169850 TCCACCTCCTGTCAGATTGGTGG + Intronic
910373403 1:86542894-86542916 TCTACCTGAGGTTGGGTTGATGG + Intergenic
910920213 1:92337755-92337777 TCCAACTCATGATAGTTTGAGGG + Intronic
911318912 1:96388261-96388283 TCCAACTGAGGTGGGATTGATGG - Intergenic
912524291 1:110269356-110269378 ACCACCACAGATTAGATTGGTGG - Intronic
912931053 1:113962119-113962141 TTCCCCTCAGGTTAGGTTAATGG - Intronic
913656422 1:120964733-120964755 TCATGCTCTGGTTAGATTGAGGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914520974 1:148415962-148415984 TCATGCTCTGGTTAGATTGAGGG + Intergenic
914646383 1:149656463-149656485 TCATGCTCTGGTTAGATTGAGGG + Intergenic
918337263 1:183529687-183529709 TGTACCTCAGTTTAAATTGAAGG - Intronic
919866460 1:201786717-201786739 TCCACCCAAAGTAAGATTGAAGG + Intronic
920170169 1:204067107-204067129 CCCACCTCAGGTCAGCCTGAAGG + Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
1063045947 10:2392696-2392718 TCCACCTCAACCTAGATTGGTGG + Intergenic
1063484653 10:6408314-6408336 CCAAACTCAGGTTTGATTGATGG + Intergenic
1064249627 10:13696956-13696978 GCTAACTGAGGTTAGATTGATGG + Intronic
1064838551 10:19562748-19562770 TCCACCTCCTGTCAGATTGGTGG + Intronic
1065263268 10:23948385-23948407 TCAAATTTAGGTTAGATTGAAGG + Intronic
1066296909 10:34061940-34061962 TCCACCTCATGTTACATTTGTGG + Intergenic
1073862760 10:107766448-107766470 TCCACCTCCTGTCAGATTCACGG + Intergenic
1073935238 10:108623435-108623457 TCCACCTTAGGGTAGATAGAAGG - Intergenic
1076124574 10:127963649-127963671 TCCACCCCAGGTGAGATCGGAGG - Intronic
1081380969 11:42414844-42414866 TCCAACGCAGAATAGATTGAAGG + Intergenic
1086734322 11:90286860-90286882 TCCACCTCCTGTTAGATCAATGG - Intergenic
1089716149 11:120361246-120361268 TCCACCTCCTGTCAGATTGCTGG + Intronic
1090894122 11:130954290-130954312 TCCACCTCACTTTAGATTCAGGG - Intergenic
1090899438 11:131014186-131014208 CCCACCTCAGGTGACAATGAAGG + Intergenic
1092830672 12:12441451-12441473 TCCACCTCAGGTTTTCGTGAGGG + Intronic
1094265816 12:28558431-28558453 TCCACTTCAGGTTTGATACAAGG - Intronic
1095697715 12:45159373-45159395 TCCACCTCTTGTCAGATTAACGG - Intergenic
1103510174 12:121468070-121468092 CCCACCTCAGGGTAGAGTCAGGG - Intronic
1103860262 12:124006819-124006841 TCCTCCTCAGGTCAGAAAGAGGG + Intronic
1103945870 12:124526235-124526257 TCCACCCCAGGTGACAGTGAGGG + Intronic
1116058162 14:39888968-39888990 TCCACCTCCTGTTAGATTGGTGG + Intergenic
1119428804 14:74552406-74552428 TCCACCGCTGGTTACCTTGAGGG - Intronic
1119866649 14:77980319-77980341 TCCTCCCCAGGTTGGACTGATGG - Intergenic
1122285667 14:100650863-100650885 TCCACCTCCTTTTAGATTGCTGG + Intergenic
1123420186 15:20124987-20125009 TCCCCCTCATCTTAGATTTATGG + Intergenic
1123529410 15:21131523-21131545 TCCCCCTCATCTTAGATTTATGG + Intergenic
1126681042 15:51202435-51202457 TCCAAATCAGGTCAGATTCATGG - Intergenic
1130284358 15:82542596-82542618 TCCACCTCAGACTAAATTGGAGG + Intronic
1139430432 16:66908262-66908284 TCCACCCCAGGGCAGATGGAGGG + Exonic
1140213271 16:72987451-72987473 GCCACCTCAGTTTAGGTAGAGGG + Intronic
1143386046 17:6531169-6531191 TCCATCTAAGGTTAAAGTGAAGG + Intronic
1146920225 17:36705061-36705083 TCACCCTCAGGTGAGAGTGAAGG + Intergenic
1153396469 18:4627408-4627430 AGCACCTCAGGTTAGAGTGTGGG - Intergenic
1154476926 18:14769670-14769692 TCTCCCTCAGCATAGATTGATGG + Intronic
1158545074 18:58389225-58389247 TCCACCTGAGGCAGGATTGAGGG + Intronic
926966845 2:18424452-18424474 CCCACCTCATGTTAGAAAGAAGG + Intergenic
933918959 2:87025565-87025587 TCCACTTCAGGTGAGATGGAAGG - Intergenic
934004035 2:87744349-87744371 TCCACTTCAGGTGAGATGGAAGG + Intergenic
934272347 2:91547026-91547048 TCCCCCTCATCTTAGATTTATGG + Intergenic
936148390 2:109996937-109996959 TCCCCCTCATCTTAGATTTATGG + Intergenic
936196287 2:110374431-110374453 TCCCCCTCATCTTAGATTTATGG - Intergenic
937421510 2:121760159-121760181 TCCACCTCCTGTCAGATTGGTGG + Intronic
939330524 2:140753699-140753721 ACCACCTCAGTTCAGCTTGATGG + Intronic
940491790 2:154371153-154371175 GCCACCTAAGTGTAGATTGAAGG + Intronic
946584653 2:221171336-221171358 TAGAACTCAGGATAGATTGATGG + Intergenic
948521763 2:238543670-238543692 GCCACCTCAGGGAAGATTCAAGG + Intergenic
1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG + Intronic
1179143181 21:38745212-38745234 TACACCTCAAAATAGATTGAAGG + Intergenic
1181352304 22:22267676-22267698 TCCCCCTCATCTTAGATTTATGG + Intergenic
949249175 3:1962157-1962179 ACCATTTCAGTTTAGATTGACGG - Intergenic
951378982 3:21959465-21959487 TCCCCTTCAGCTGAGATTGAAGG + Intronic
957402275 3:79731655-79731677 TATACTTCAGGATAGATTGATGG + Intronic
957833554 3:85554293-85554315 TCCACCTCCTGTCAGATTCAGGG - Intronic
969220601 4:5756159-5756181 TGCATCTCAGGTTAGAAAGAAGG - Intronic
974270660 4:59647068-59647090 TCCACCTAATTTTGGATTGATGG - Intergenic
979339876 4:119509827-119509849 TCTACCTCAGGTAAGAGAGAGGG + Intronic
985331724 4:188844720-188844742 TCCACCTAATTTCAGATTGAGGG + Intergenic
986228292 5:5837960-5837982 TCCTCCTCAGGTTTGTTTGCTGG - Intergenic
996461198 5:123745058-123745080 TCCACCTCAGGTTACGATGTAGG - Intergenic
996619347 5:125481151-125481173 CCCACATCAGGTTAGGTGGATGG - Intergenic
997593062 5:135087310-135087332 TCCAGCTGAAGTTAGGTTGAAGG + Intronic
1007662791 6:43496744-43496766 TCCAGCTCTGTTTAGGTTGATGG + Intronic
1012835526 6:104260709-104260731 TCTACCTCATGTGAGATTAAAGG + Intergenic
1014391280 6:120868673-120868695 TCCACTGCAGGTTAGATGGCAGG + Intergenic
1017908927 6:158776280-158776302 TCCTCATGAGGTTACATTGAGGG - Intronic
1018127823 6:160698491-160698513 TCCACTTCAGGTGAGATGGAAGG + Intergenic
1019885201 7:3898115-3898137 TTCAACTCAGGTTACATTCATGG - Intronic
1023770347 7:43551186-43551208 TCCACCACTGGTTTGATTAAAGG + Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1035860010 8:3018361-3018383 TCCACCCCAGGTAGGATTTAAGG + Intronic
1038612865 8:29070754-29070776 TCCCCCGCAGGTAAGAATGACGG - Exonic
1038701141 8:29850282-29850304 TCCATCTCAGATTATATTAAGGG - Intergenic
1047526100 8:125635395-125635417 TCCTCCTGAGGGTAGGTTGAGGG + Intergenic
1048724206 8:137363213-137363235 TCCACCTACTGTTAGATTGGTGG - Intergenic
1049994386 9:1020851-1020873 ACCACCTCAGGTTGGTGTGAAGG + Intergenic
1061610792 9:131744319-131744341 CCCACCTCAGCTTGGATTGGTGG + Intergenic
1186407874 X:9319633-9319655 TTCACTTCAGGTTAAGTTGAAGG - Intergenic
1195052413 X:101109050-101109072 CACACCTCACGTTATATTGAAGG - Intronic
1201052406 Y:9950581-9950603 TCCACCTCAGGTCACACTCAGGG + Intergenic