ID: 1173497068

View in Genome Browser
Species Human (GRCh38)
Location 20:43527435-43527457
Sequence TCCACCTCAGGTTAGATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173497063_1173497068 15 Left 1173497063 20:43527397-43527419 CCTTTAAAGGGTGTTTGTCCTCT No data
Right 1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG No data
1173497066_1173497068 -3 Left 1173497066 20:43527415-43527437 CCTCTGTTAGAGGCTAGGACTCC No data
Right 1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173497068 Original CRISPR TCCACCTCAGGTTAGATTGA AGG Intronic