ID: 1173497965

View in Genome Browser
Species Human (GRCh38)
Location 20:43532778-43532800
Sequence CCCACCCCTGGGCTTCCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 0, 3: 70, 4: 437}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173497955_1173497965 -2 Left 1173497955 20:43532757-43532779 CCTTTTTTTCCCCTAGAGTCCCC 0: 1
1: 0
2: 1
3: 41
4: 357
Right 1173497965 20:43532778-43532800 CCCACCCCTGGGCTTCCAGGTGG 0: 1
1: 0
2: 0
3: 70
4: 437
1173497951_1173497965 24 Left 1173497951 20:43532731-43532753 CCAGCTTGGCCCTGGCCGTGGCA 0: 1
1: 0
2: 4
3: 24
4: 239
Right 1173497965 20:43532778-43532800 CCCACCCCTGGGCTTCCAGGTGG 0: 1
1: 0
2: 0
3: 70
4: 437
1173497954_1173497965 9 Left 1173497954 20:43532746-43532768 CCGTGGCAGCTCCTTTTTTTCCC 0: 1
1: 0
2: 2
3: 47
4: 368
Right 1173497965 20:43532778-43532800 CCCACCCCTGGGCTTCCAGGTGG 0: 1
1: 0
2: 0
3: 70
4: 437
1173497952_1173497965 15 Left 1173497952 20:43532740-43532762 CCCTGGCCGTGGCAGCTCCTTTT 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1173497965 20:43532778-43532800 CCCACCCCTGGGCTTCCAGGTGG 0: 1
1: 0
2: 0
3: 70
4: 437
1173497953_1173497965 14 Left 1173497953 20:43532741-43532763 CCTGGCCGTGGCAGCTCCTTTTT 0: 1
1: 0
2: 7
3: 18
4: 223
Right 1173497965 20:43532778-43532800 CCCACCCCTGGGCTTCCAGGTGG 0: 1
1: 0
2: 0
3: 70
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173497965 Original CRISPR CCCACCCCTGGGCTTCCAGG TGG Exonic