ID: 1173498040

View in Genome Browser
Species Human (GRCh38)
Location 20:43533269-43533291
Sequence CCATGCTTTCAGAGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173498030_1173498040 13 Left 1173498030 20:43533233-43533255 CCTCTCACTAAGAAGTAGATGAG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1173498040 20:43533269-43533291 CCATGCTTTCAGAGGATGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 217
1173498028_1173498040 24 Left 1173498028 20:43533222-43533244 CCATCTGTCTCCCTCTCACTAAG 0: 1
1: 0
2: 3
3: 73
4: 604
Right 1173498040 20:43533269-43533291 CCATGCTTTCAGAGGATGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 217
1173498029_1173498040 14 Left 1173498029 20:43533232-43533254 CCCTCTCACTAAGAAGTAGATGA 0: 1
1: 1
2: 0
3: 6
4: 212
Right 1173498040 20:43533269-43533291 CCATGCTTTCAGAGGATGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 217
1173498027_1173498040 29 Left 1173498027 20:43533217-43533239 CCTTGCCATCTGTCTCCCTCTCA 0: 1
1: 0
2: 2
3: 79
4: 647
Right 1173498040 20:43533269-43533291 CCATGCTTTCAGAGGATGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173498040 Original CRISPR CCATGCTTTCAGAGGATGGC AGG Intronic
900249479 1:1659949-1659971 CCATGGATTCAGAGCATTGCAGG + Intronic
900260415 1:1725260-1725282 CCATGGATTCAGAGCATTGCAGG + Intronic
900615539 1:3564116-3564138 CCCTGCTTACAGACTATGGCAGG + Intronic
900966151 1:5960134-5960156 TCTTCCTTTCAGAGGATTGCAGG + Intronic
901142331 1:7043172-7043194 GCTTGCTTTCATAGGATGGTGGG + Intronic
903391327 1:22965417-22965439 CCTTGCTCTCCCAGGATGGCTGG - Intergenic
903399577 1:23031237-23031259 ACTAGCTTTCTGAGGATGGCTGG + Intronic
909250244 1:73344320-73344342 CCAAGATTTCAGAGGATGTATGG + Intergenic
912516631 1:110220436-110220458 CCCTGCTATGAGAGGATGGCCGG + Intronic
913018563 1:114764147-114764169 CCTTGATTTCAGAGGATGTACGG + Intergenic
913179077 1:116302074-116302096 GCATGCATCCAGAGGTTGGCTGG + Intergenic
913289448 1:117258771-117258793 CCTAGATTTCAGAGGATGGATGG - Intergenic
913535912 1:119771953-119771975 CCATGCTTTCAGTCAATCGCAGG + Intergenic
916356797 1:163918927-163918949 CCAAGATTCCAGAGGAAGGCAGG + Intergenic
916679952 1:167094822-167094844 CCAAACTTTCAGAGGTTGGCAGG + Exonic
918844773 1:189595028-189595050 CTTAGATTTCAGAGGATGGCTGG + Intergenic
919212796 1:194510143-194510165 CTATGCTTTCAGAAGAAGCCAGG - Intergenic
920192620 1:204203119-204203141 TCATGCTCTCAGGGGATGGTGGG + Intronic
921531259 1:216285425-216285447 CCTAGCTTTCAGAGGATGTATGG + Intronic
923754861 1:236782996-236783018 ACATACTTTCAGAAGTTGGCCGG + Intergenic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
924552626 1:245092524-245092546 CCATGCTTTCAGAAATAGGCAGG - Intronic
924767554 1:247047673-247047695 CCACGATTTCAGAGGATGTGTGG - Intronic
1066291442 10:34017747-34017769 CCACGCTTTGAGAGGACAGCAGG + Intergenic
1072255949 10:93620457-93620479 CTATGCAGTCATAGGATGGCAGG + Intronic
1072553177 10:96494363-96494385 CCTGGCTCTCAGAGAATGGCAGG + Intronic
1072709868 10:97709193-97709215 CCATGGGTCCAGAGCATGGCTGG - Intergenic
1072735759 10:97878425-97878447 CCATGATATCAGAAAATGGCAGG + Intronic
1074628402 10:115220413-115220435 TCATGGTTTCATTGGATGGCTGG + Intronic
1076436960 10:130453127-130453149 CAAAGCTTGCAGAGGCTGGCTGG - Intergenic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078682127 11:13486958-13486980 CCAAGCTTTCATAGCATGGAAGG + Intergenic
1078826978 11:14938885-14938907 CCAAGATTTCAGAGGATGTATGG - Intronic
1080331792 11:31147757-31147779 CCATAATTTAATAGGATGGCAGG + Intronic
1081204941 11:40263960-40263982 CCATGCTTTCTTAGGAGGACTGG - Intronic
1081523739 11:43908471-43908493 ATATGCTTTCAGAGGATGAAGGG + Intronic
1084068013 11:66716538-66716560 CCATGGTTTCTGAGGATGAAAGG - Intronic
1084604832 11:70166411-70166433 CCATGCTGGCTGAGGATGGGGGG + Intronic
1084650328 11:70485843-70485865 CAAAGCTTTCAGGGGGTGGCAGG + Intronic
1087155438 11:94897190-94897212 GCCTGCTTTCAGAAAATGGCTGG + Intergenic
1089071103 11:115700354-115700376 ACGTGCTTTCAGAGGCTGCCAGG - Intergenic
1091146182 11:133282461-133282483 CCAAGATTTCAGAGGATGTATGG + Intronic
1093682904 12:22023624-22023646 CCAAGATTTCAGAGGATGTATGG + Intergenic
1094724296 12:33097233-33097255 CCATTCATTCACAAGATGGCTGG - Intergenic
1096731200 12:53614162-53614184 CTAGGCTTTCAGAGGATTCCAGG + Intronic
1097395225 12:59065040-59065062 ACATGCTTTTTGATGATGGCTGG - Intergenic
1097654686 12:62344718-62344740 CCTTGATTTCAGAGGATGTATGG - Intronic
1099669704 12:85674313-85674335 CCAAGATTTCAGAGGATGTATGG - Intergenic
1101519030 12:105464558-105464580 CCCTCCTTTCAGAGTCTGGCTGG + Intergenic
1101825727 12:108218649-108218671 CCATGCTCTTAGAGGATGCAAGG + Intronic
1106133810 13:26959803-26959825 CCAGGGTTTCAGAGCACGGCTGG + Intergenic
1106605003 13:31220997-31221019 GCATGCTTCCCGAGGAAGGCTGG + Intronic
1107028233 13:35825010-35825032 CTATGTGTTCAGAGGAAGGCAGG - Intronic
1108524058 13:51270737-51270759 CCATGTATTCTGAGGAAGGCTGG + Intronic
1108750255 13:53440507-53440529 CCAAGCTTCCAGAGCATGGAAGG - Intergenic
1109407319 13:61918829-61918851 CCTAGATTTCAGAGGATGGATGG - Intergenic
1112482925 13:99793630-99793652 CCTTGCATTAAGAGGATGCCTGG - Intronic
1113264881 13:108606569-108606591 CCTTGCTTTCAGAGGATGTATGG + Intronic
1113692042 13:112317973-112317995 CCATTCTTTCAGATGGTGTCAGG + Intergenic
1113914351 13:113861910-113861932 CCAGGCTGTGAGAGGATGGGAGG + Intronic
1115277302 14:31622740-31622762 CCTTGATTTCAGAGGATGTATGG + Intronic
1118273072 14:64361544-64361566 CCTTGCTTTCAGAGTTTGGCTGG + Intergenic
1118533001 14:66728186-66728208 CCTAGATTTCAGAGGATGGATGG + Intronic
1119775372 14:77244736-77244758 CCATGCCTTCAGGATATGGCTGG - Intronic
1120417942 14:84243569-84243591 CCTAGCTTTCAGAGGATGTATGG - Intergenic
1121965175 14:98296974-98296996 CCATGCTGCCTGAGAATGGCTGG - Intergenic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1124716973 15:32072844-32072866 CCTAGCTTTCAGAGGATGTATGG + Intronic
1124797548 15:32796910-32796932 CCATCCTCACAGAGCATGGCTGG + Intronic
1125758381 15:42081275-42081297 CATTGCTTCCAGAGGAGGGCTGG - Intronic
1128784115 15:70382385-70382407 CATTCCTTTCAGAGGATGTCTGG + Intergenic
1130082492 15:80746661-80746683 TCATGATCTCTGAGGATGGCTGG + Intronic
1130710284 15:86273766-86273788 CCATGTTTTAAGAGGATGCCAGG + Intronic
1131198850 15:90379489-90379511 CCTTGATTTCAGAGGATGTATGG - Intergenic
1131414757 15:92244932-92244954 CCATGATCTCAGAGGGTGGTGGG + Intergenic
1131641815 15:94301238-94301260 GCATGCTTGCAGAGGACGGAGGG + Intronic
1133416482 16:5611166-5611188 CCAAGATTTCAGGGGAAGGCAGG - Intergenic
1133655056 16:7853427-7853449 ACAACCTGTCAGAGGATGGCAGG + Intergenic
1134604213 16:15557359-15557381 CCATGCTTTAGAAGCATGGCTGG - Intronic
1138984256 16:62307745-62307767 GCATGCTTTCAGAGTCTTGCAGG + Intergenic
1141769711 16:86082423-86082445 TCAAGCTTTTAAAGGATGGCAGG + Intergenic
1142820997 17:2467107-2467129 CAATGCTTTCAATGCATGGCTGG + Intronic
1143654438 17:8285674-8285696 CCATTCATTCAGAGGAGGTCTGG + Intergenic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1147003756 17:37385164-37385186 CCTTGCTTTCAAAGGATCTCTGG - Intronic
1148710702 17:49678604-49678626 CTATCCTTTCAGGGGAAGGCAGG + Intergenic
1151519512 17:74618076-74618098 CCATGCATTCAGAGGAAAGAGGG + Intronic
1155483224 18:26312403-26312425 CCATGGTTACAGATGGTGGCAGG - Intronic
1156350897 18:36300073-36300095 CCATGCATTCAGAGCCTGGGTGG - Intronic
1158299239 18:56033345-56033367 CCTAGCTTTCAGAGGATGTATGG - Intergenic
1164432537 19:28200701-28200723 TCCTGCTTGCAGAGGATGCCAGG + Intergenic
1165215697 19:34270616-34270638 CCATGGGTTCAGAGGAAGGAGGG - Intronic
926259296 2:11242502-11242524 CCTTCCTTCCAGATGATGGCTGG + Intronic
927805289 2:26141419-26141441 CCCTGGTTTCAGAGGAGGGAGGG - Intergenic
929764242 2:44831027-44831049 CCCTGCCTTCAGAGGAAGCCCGG + Intergenic
931390744 2:61841472-61841494 CCAAGCTTTCAGAGGGATGCAGG - Intronic
936161810 2:110089095-110089117 CCATGATTTCAGAGGATGTATGG + Intronic
936182853 2:110282259-110282281 CCATGATTTCAGAGGATGTATGG - Intergenic
936837445 2:116725136-116725158 CCATGGTTTAAGAAGATGGTTGG + Intergenic
936897597 2:117445871-117445893 CCTAGATTTCAGAGGATGGATGG + Intergenic
936905743 2:117534004-117534026 CCTTGATTTCAGAGGATGTATGG + Intergenic
939506407 2:143052694-143052716 CCAAGATTTCAGAGGATGTATGG + Exonic
939982333 2:148796436-148796458 CCATTCATTCAGAGGATGACCGG - Intergenic
940025337 2:149200778-149200800 TCAGGCTTCCAGAGAATGGCAGG - Intronic
942517934 2:176773179-176773201 CCTAGATTTCAGAGGATGGGTGG + Intergenic
944828211 2:203506127-203506149 CCATGCTTTGAGAGGAAAGGGGG + Intronic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
948545809 2:238727955-238727977 TCATGCTTCCAAAGGAGGGCAGG - Intergenic
1170566393 20:17610238-17610260 CCAGGGTTTCAGTGGAAGGCAGG + Intergenic
1170575168 20:17657185-17657207 CCCTACTTCCAGAGGCTGGCAGG - Intronic
1172183965 20:33020063-33020085 CCATCCTTTCAGAGAGTGGCAGG - Intronic
1173178825 20:40786324-40786346 CAAGGCTATCAGAGGATGGTAGG - Intergenic
1173498040 20:43533269-43533291 CCATGCTTTCAGAGGATGGCAGG + Intronic
1181037178 22:20175333-20175355 ACAGGATTTCAGAGGATGGCAGG - Intergenic
1183358495 22:37371697-37371719 CCATGGTGACAGAGGCTGGCTGG + Exonic
949581684 3:5394805-5394827 CCTTCCTTTAAGAGGGTGGCTGG + Intergenic
949852702 3:8434860-8434882 CCAGGCACTCAGAGGCTGGCAGG - Intergenic
951449370 3:22819179-22819201 CCAAGATTTCAGAGGATGTATGG - Intergenic
951965978 3:28385450-28385472 CCATGCTTTCAGAATAGTGCTGG - Intronic
952331436 3:32367548-32367570 TGATGCTGTCTGAGGATGGCAGG - Intronic
952809411 3:37387821-37387843 CCATCCTTCCAGAGGCTGTCCGG + Intronic
953492247 3:43362167-43362189 CAAGGCTTACAGAGGATGGTGGG + Intronic
954985371 3:54786002-54786024 CCATGATGGCAGAGGGTGGCTGG - Intronic
955471889 3:59294890-59294912 CCTTGATTTCAGAGGATGTATGG - Intergenic
957918646 3:86719494-86719516 CCATGTTTTCAAAGCATGCCAGG - Intergenic
958537708 3:95425366-95425388 CCAAGATTTCAGAGGATGTATGG - Intergenic
958609792 3:96410447-96410469 CCTAGATTTCAGAGGATGGATGG - Intergenic
963982602 3:151556696-151556718 CCAGCCTTTGAGAGGATGGTAGG + Intergenic
964539348 3:157762006-157762028 CCCTGCTTTCAGGGGATTGTTGG - Intergenic
965961428 3:174433051-174433073 CCGTACTTTCAGAGTATGACAGG + Intergenic
966972818 3:185061023-185061045 CCTAGATTTCAGAGGATGTCTGG + Intergenic
967586076 3:191216056-191216078 CCTTGATTTCAGAGGATGTATGG - Intronic
968542755 4:1176169-1176191 CCATGCTCTCAGAGTCTTGCTGG + Intronic
970100376 4:12514790-12514812 CCTAGATTTCAGAGGATGGACGG + Intergenic
973642836 4:52920231-52920253 CACTGCTTTCAAAGGAGGGCAGG - Intronic
975343679 4:73269589-73269611 GCATGCTTTCATATGATTGCTGG + Intergenic
975854936 4:78614259-78614281 CTTTGGTTTCAGAGGAGGGCTGG - Intergenic
976875609 4:89850321-89850343 CCAAGATTTCAGAGGATGTAAGG - Intergenic
977610138 4:99022340-99022362 CCATGCTCTCTGAGGGTGGCGGG + Intronic
977973053 4:103233072-103233094 CCATGGCTTCAGAGGATGTAAGG + Intergenic
978474969 4:109116245-109116267 TCATGCTTTCAGATGAAGGAGGG + Intronic
980083598 4:128369206-128369228 CCATGATTTCAGAAGATGTAAGG - Intergenic
980201297 4:129658821-129658843 CCTTGATTTCAGAGGATGTATGG - Intergenic
980248412 4:130279422-130279444 TCAGACTTACAGAGGATGGCAGG - Intergenic
981634261 4:146857614-146857636 CCCTTCTCCCAGAGGATGGCTGG - Intronic
985335053 4:188883386-188883408 CCTTGCTTTCGGAGGTTTGCCGG + Intergenic
986269494 5:6218488-6218510 CCATGCATCCAGAGGCTGGGAGG - Intergenic
987869619 5:23598413-23598435 CAGTGCTTTCGGAGGAAGGCTGG + Intergenic
988644150 5:33075508-33075530 CCATGCTTTCATTGGGTTGCAGG - Intergenic
990811635 5:59731616-59731638 CCATGTTTTAAAAGTATGGCAGG - Intronic
992084115 5:73262636-73262658 CCATGCATTCTGAGGGTTGCTGG + Intergenic
993390978 5:87319419-87319441 CCTTGATTTCAGAGGATGTATGG - Intronic
996108270 5:119533182-119533204 CTCTGCTTTCAGAGAATGGGAGG + Intronic
997110531 5:131069478-131069500 CCATGCTTTCAGAGCAACACAGG + Intergenic
997438552 5:133892473-133892495 CTTTGCTCTCTGAGGATGGCTGG + Intergenic
997679512 5:135739576-135739598 CCAAGCTTTCACAAGATGGCAGG + Intergenic
999571213 5:152921777-152921799 ACATGCTTTTGGATGATGGCTGG - Intergenic
999906156 5:156143268-156143290 CCAAGATTTCAGAGGATGTGTGG + Intronic
1000703693 5:164485345-164485367 TCATACTTTCAGAGGATAGATGG - Intergenic
1001073386 5:168605953-168605975 CCATGCCTTCACAGGATCCCTGG + Intergenic
1001876494 5:175206271-175206293 CCACCCTATCAGAGGATGGTGGG - Intergenic
1002539595 5:179897518-179897540 CCATGTTGGCAAAGGATGGCTGG + Intronic
1002584260 5:180231937-180231959 CCAAGCTTTCAGAGGAGCCCTGG - Intergenic
1003158704 6:3617802-3617824 CCCTGCTTTCTGGGCATGGCTGG + Intergenic
1003226895 6:4214167-4214189 CCAAGATTTCAGAGGATGTATGG - Intergenic
1003293861 6:4806273-4806295 CCAGGATTTCAGAGCAGGGCAGG + Intronic
1005499603 6:26418308-26418330 CCAAGATTTCAGAGGATGTATGG - Intergenic
1005520775 6:26598594-26598616 CCATGCTCTCTGAGGGTGGCGGG - Exonic
1007526018 6:42494318-42494340 ACATGCTTACATAGGATGCCTGG + Intergenic
1009524308 6:64724268-64724290 ACATGCTTTGAGAGGCTGGCAGG - Intronic
1010103576 6:72140974-72140996 CTATCCTTCCACAGGATGGCAGG + Intronic
1011784565 6:90829428-90829450 CCAGGGTTTCAGATGCTGGCAGG + Intergenic
1012097169 6:94977316-94977338 CCTAGATTTCAGAGGATGGATGG - Intergenic
1012558009 6:100540162-100540184 CCAAGCTCTCAGAGTATGTCAGG - Exonic
1015206092 6:130640512-130640534 ACATGTTTTCAAGGGATGGCAGG - Intergenic
1017518623 6:155181248-155181270 CCATGCATTCAGAAGAGGGAAGG + Intronic
1019465402 7:1185480-1185502 CCATCCTTTCAGGGCATGGCAGG - Intergenic
1021870766 7:25004023-25004045 CCAGACTTCCAGAGGAAGGCTGG + Intergenic
1023236864 7:38099186-38099208 CCTAGATTTCAGAGGATGGATGG + Intergenic
1023406903 7:39843177-39843199 CCTAGCTTTCAGAGGATGTATGG + Intergenic
1023862876 7:44226408-44226430 CCATTCTTGCGGAGGAGGGCGGG - Intronic
1023992233 7:45135116-45135138 CCATGTCTGCAGAGCATGGCGGG - Intergenic
1024303347 7:47904694-47904716 CTATACTTTAAGAGGAAGGCGGG + Intronic
1026879778 7:73901111-73901133 CCACGCCTTCAGAGGCTGGGAGG - Intergenic
1028286748 7:89012019-89012041 CCTAGCTTTCAGAGGATGTACGG - Intronic
1030196406 7:106857739-106857761 CCATGCTTTGTGATGATGACAGG + Intergenic
1033031597 7:137832355-137832377 CCTTGATTTCAGAGGATGTATGG - Intronic
1034750057 7:153560125-153560147 CCATGGTTTCAGAGGGTGCAAGG - Intergenic
1035840916 8:2811175-2811197 CCACCCTTTCAGGAGATGGCTGG - Intergenic
1037637330 8:20711713-20711735 CCAACCTTTTAGAGGATGCCTGG - Intergenic
1037709682 8:21345758-21345780 CCATCCTTGCAGAGCAGGGCTGG - Intergenic
1038424716 8:27457676-27457698 TCAAGCCTTCAGTGGATGGCTGG + Intronic
1039354932 8:36804554-36804576 GGATGCTTTCAGAGGACAGCAGG - Intronic
1042232833 8:66576125-66576147 CTCTTCTTTCTGAGGATGGCTGG + Exonic
1042631508 8:70821591-70821613 CCTAGATTTCAGAGGATGGATGG - Intergenic
1042693711 8:71532263-71532285 CTGTGCTTTCAGTGGATGGGAGG - Intronic
1043065723 8:75567866-75567888 CCTAGATTTCAGAGGATGTCCGG - Intergenic
1046134690 8:110011098-110011120 CCTTGGTTTCAGAGGATGTATGG + Intergenic
1046564630 8:115883346-115883368 CAAAGCTTTCAGAGGATGCAGGG - Intergenic
1047263056 8:123279559-123279581 CCACACATTCAGTGGATGGCTGG + Intergenic
1048729186 8:137418793-137418815 CCTAGCTTTCAGAGGATGTATGG - Intergenic
1048915857 8:139182141-139182163 CCTAGATTTCAGAGGATGTCTGG + Intergenic
1050144621 9:2553535-2553557 CCAGGGTTTCAGAGGGAGGCAGG + Intergenic
1050674528 9:8036868-8036890 CCAGGATTTCAGAGGATGTATGG - Intergenic
1052079067 9:24180544-24180566 CCTTGATTTCAGAGGATGTATGG - Intergenic
1052087956 9:24291086-24291108 CCTAGATTTCAGAGGATGGATGG - Intergenic
1055353992 9:75418442-75418464 CCATGCTGGGAGAGTATGGCTGG - Intergenic
1055701285 9:78948198-78948220 CCAAGATTTCAGAGGATGTATGG + Intergenic
1056788083 9:89606607-89606629 GCAGGGTTTCAGAGGATTGCTGG + Intergenic
1057815010 9:98287692-98287714 CTGTGCTTTCAGAGGAGCGCAGG + Intergenic
1058223015 9:102325938-102325960 CCAAGATTTCAGAGGATGTATGG + Intergenic
1059636841 9:116179643-116179665 TCAGGCATTCAGAGGAAGGCTGG - Intronic
1060246151 9:121947929-121947951 CCGTGCTTTTGGAGGATGGAAGG + Intronic
1062359837 9:136182465-136182487 GCATGATGTCAGAGGCTGGCAGG - Intergenic
1185718270 X:2360915-2360937 TGATGCTTTCAGAGGAAGGATGG + Intronic
1187625074 X:21102230-21102252 CTAAGCTCTGAGAGGATGGCTGG + Intergenic
1188169921 X:26911768-26911790 CCTAGCTTTCAGAGGATGTATGG + Intergenic
1190269663 X:48852863-48852885 CCTAGCTTTCAGAGGATGTATGG - Intergenic
1191258899 X:58292001-58292023 CCAGGCTTTCAGAGGGATGCTGG + Intergenic
1191682427 X:63854937-63854959 CTTTGCTTCCAGAGGATGGTGGG - Intergenic
1192131885 X:68559364-68559386 CCTTGATTTCAGAGGATGTGTGG - Intergenic
1194220467 X:91183362-91183384 CCTAGATTTCAGAGGATGGATGG + Intergenic
1194274105 X:91858055-91858077 CCAAGATTTCAGAGGATGTAGGG - Intronic
1194638253 X:96372308-96372330 CAATGTTTTCAGGGGATGTCTGG - Intergenic
1195536314 X:106012841-106012863 CCTTGATTTCAGAGGATGTATGG + Intergenic
1196178356 X:112664854-112664876 CCATTCTTTCAGAAGGTGGCAGG - Intronic
1197578788 X:128256068-128256090 CCAAGATTTCAGAGGATGTATGG - Intergenic
1198502388 X:137264387-137264409 CCAGGATTTCAGAGGATCCCAGG + Intergenic
1198941720 X:141963968-141963990 CCAAGATTTCAGAGGATGTATGG - Intergenic
1199806487 X:151305605-151305627 CCTAGATTTCAGAGGATGGATGG - Intergenic
1200353753 X:155526416-155526438 CCTAGATTTCACAGGATGGCTGG + Intronic
1200556979 Y:4647114-4647136 CCTAGATTTCAGAGGATGGATGG + Intergenic
1200591340 Y:5079466-5079488 CCAAGATTTCAGAGGATGTAGGG - Intronic
1201147519 Y:11073062-11073084 CCATGCTCCCAGAGGAGGGGTGG + Intergenic