ID: 1173498320

View in Genome Browser
Species Human (GRCh38)
Location 20:43534724-43534746
Sequence TCCAGGATCTTGCTTCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173498313_1173498320 19 Left 1173498313 20:43534682-43534704 CCAAGACAGATTATTGCAGGGTT 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1173498319_1173498320 -8 Left 1173498319 20:43534709-43534731 CCTTGGTTCTTTCAATCCAGGAT 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1173498318_1173498320 -7 Left 1173498318 20:43534708-43534730 CCCTTGGTTCTTTCAATCCAGGA 0: 1
1: 0
2: 1
3: 17
4: 192
Right 1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1173498316_1173498320 -6 Left 1173498316 20:43534707-43534729 CCCCTTGGTTCTTTCAATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG 0: 1
1: 0
2: 0
3: 8
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173498320 Original CRISPR TCCAGGATCTTGCTTCTGAC AGG Intronic
900464362 1:2817847-2817869 TCTAGGACCTTGGTTCTTACAGG + Intergenic
902054545 1:13589426-13589448 TACAGGATCTAGATTCTGAATGG + Intronic
904136099 1:28313802-28313824 TCCTGGCTCTGGCTTCTCACTGG - Intergenic
904807181 1:33140404-33140426 CCCAGGACCTCGCTTCTGATTGG + Intergenic
907838646 1:58135263-58135285 TCCAGGAGCCTCCTTCTGAGAGG + Intronic
910268460 1:85366683-85366705 TCCAGCCTCTTGCCTCTGATTGG - Intronic
911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG + Intronic
913049388 1:115103647-115103669 TCCAGCATCTTGTTTCTTAAAGG - Intergenic
921794972 1:219332263-219332285 TCCAGGATCCTGCTGTTGGCTGG - Intergenic
922965706 1:229689204-229689226 TCCAGAATCATCCTTCTGAAGGG + Intergenic
1062926399 10:1318728-1318750 TCCCCGATATTCCTTCTGACAGG - Intronic
1065574727 10:27105756-27105778 ACCAGGACCTTGCTTCTGCCAGG + Intergenic
1067214394 10:44289456-44289478 TCCAGGAATTTGCTTCTCCCTGG + Intergenic
1067431113 10:46246723-46246745 TCCAGGATCTCCCCTCAGACAGG - Intergenic
1067442294 10:46315504-46315526 TCCAGGATCTCCCCTCAGACAGG + Intronic
1069114331 10:64485969-64485991 TCCAGGATGTTGCATATGATGGG + Intergenic
1069994151 10:72332409-72332431 CCCAGGATCTGGCTCCTGAGTGG + Intergenic
1073909584 10:108325891-108325913 TCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1081437947 11:43048618-43048640 TACAGAATCTATCTTCTGACAGG + Intergenic
1082314925 11:50706224-50706246 TCCAGGATCTGGTTTTTGAAAGG - Intergenic
1083504402 11:63142251-63142273 TCCAGCTTCTTCCTGCTGACAGG - Intronic
1083684397 11:64368034-64368056 TCCAGGGTCTTGCCTTTGCCTGG + Intronic
1085743335 11:79095041-79095063 TCCAAGATCTTGCATCAGCCTGG + Intronic
1087908861 11:103729753-103729775 TCCAAGATCAAGGTTCTGACAGG + Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1093768077 12:22987742-22987764 TCCAGGAACTTGCTTTTCAAAGG + Intergenic
1094251473 12:28367002-28367024 TTCAGGAGATTTCTTCTGACAGG - Intronic
1094682598 12:32679379-32679401 TCCTGGAGCTTGTTTATGACAGG - Exonic
1095885234 12:47181862-47181884 TACAGGATGTTTCTTTTGACAGG - Intronic
1096569194 12:52510486-52510508 TCCAGGATCAAGATACTGACAGG + Intergenic
1097315529 12:58167051-58167073 CCCAGGAAGTTGCTTCTCACTGG + Intergenic
1097451510 12:59742255-59742277 TCCAGGAACTTGCTTCTCCCTGG + Intronic
1097718689 12:62996951-62996973 GCAAGGAACTTGCTTTTGACTGG - Intergenic
1101861454 12:108485667-108485689 TCCAGGATCAAGGTGCTGACAGG - Intergenic
1102616318 12:114157794-114157816 TCCATGGTCTTGCTTCAGAGTGG - Intergenic
1103575300 12:121872894-121872916 TCCAGGAGCTTGTTTCTGCCTGG - Intergenic
1105821629 13:24085762-24085784 GCCAGCCTCTTGCTTCTGCCAGG + Intronic
1114356184 14:21911880-21911902 TCCCTGATCTTCCTTCTGCCTGG + Intergenic
1114680071 14:24476893-24476915 TCCTGGTTCTTGCTCCTGTCTGG - Intergenic
1115278698 14:31637026-31637048 TCCAGGAGCTGGTTTCTGAAAGG - Intronic
1116901520 14:50366445-50366467 TGTAGGATCTGCCTTCTGACTGG - Intronic
1117694958 14:58351569-58351591 TGCAGGACCTTTCTTTTGACTGG - Intronic
1121500171 14:94429290-94429312 TCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1122848977 14:104516464-104516486 TGCAGGATCTTGCCTCTGTGAGG - Intronic
1125056796 15:35368836-35368858 TCTAGGTTCTTATTTCTGACTGG - Intronic
1125306548 15:38323206-38323228 TCCATGTTCTTGCCTGTGACTGG - Intronic
1128004433 15:64225499-64225521 GGCAGAATCTTGATTCTGACTGG + Intronic
1129117991 15:73375912-73375934 TCCAGGCCCCTGCTTCTGGCAGG - Intergenic
1131950898 15:97680871-97680893 TGCAGGACCTTGACTCTGACAGG - Intergenic
1136066847 16:27765186-27765208 TCCAGGACCAGGCTTCTGAATGG + Intronic
1136420915 16:30132387-30132409 TCCAGGAAATTGCTTCTCCCTGG - Intergenic
1138412750 16:56852853-56852875 TCAAGGAGCTTCCTTCTTACTGG + Intergenic
1138444111 16:57052671-57052693 TCCAGGATCTCGCTTATGCTTGG + Intronic
1139356617 16:66370780-66370802 CCCAGGCTGTTCCTTCTGACTGG - Intronic
1140575167 16:76159108-76159130 TCCATCATCTTGGTTCTAACTGG - Intergenic
1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG + Exonic
1153656553 18:7287971-7287993 GCCAGGATTTTGCTTCTGAAAGG - Intergenic
1155988078 18:32251833-32251855 GCCTGGATCTTGCTTCTTAAAGG + Intronic
1156183681 18:34636975-34636997 TCCAGGGTATTTCTTCTGAAAGG + Intronic
1156477653 18:37416343-37416365 CCCAGGAGCTGGGTTCTGACAGG - Intronic
1156717623 18:40030301-40030323 TCCAGCATCTTATTTTTGACTGG - Intergenic
1158234628 18:55299899-55299921 TCCAACATCTTCCTTCTGAAGGG + Intronic
1161042391 19:2117029-2117051 TCTGGGATCTGGCTTCTGCCTGG - Intronic
1164497480 19:28780595-28780617 ACCAGGAGCTTGCTTTTGAAAGG + Intergenic
1168289168 19:55348651-55348673 TCCAGGATCTGGATTTTGCCAGG + Intergenic
925845324 2:8028587-8028609 TCCAGGATCTCCTTTCTCACAGG + Intergenic
928915384 2:36464847-36464869 TCCAGAATCCTCCTTCTGATGGG - Intronic
930218541 2:48722168-48722190 CCCAGGATGCTGCTTCTGAATGG + Intronic
932228617 2:70063531-70063553 TCCTGGAGCTTCCTTCAGACAGG - Intergenic
939664685 2:144936598-144936620 TCCTGGATCTTGCTGCTCCCAGG + Intergenic
943428078 2:187761328-187761350 TCAAGTATCTTGCTTTTAACTGG - Intergenic
944963303 2:204901224-204901246 TCCAGGCCCTGGCTCCTGACTGG - Intronic
1170495792 20:16923861-16923883 TCATGGATCCTGCTTCTGAGAGG - Intergenic
1172115209 20:32569611-32569633 TCCAGGAGGTGGCTTCTGCCTGG - Intronic
1172637864 20:36422122-36422144 TCCAGGGCCTTGCTGCTGCCTGG - Intronic
1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG + Intronic
1174687687 20:52471297-52471319 TCCAAGAAGCTGCTTCTGACTGG - Intergenic
1175244917 20:57576283-57576305 CCCAGGGTCTTGCCTCTGGCAGG + Intergenic
1180722478 22:17919803-17919825 TCCAGGTCCTGGCTCCTGACAGG - Intronic
1182363319 22:29760642-29760664 TCCAGGCTTTTGCTTCTTAAGGG - Intronic
1184276840 22:43413463-43413485 ACCAAGATCTGGCTTCCGACTGG - Intronic
1184865012 22:47197426-47197448 TCCGGGATCCTGCTCCTGCCTGG + Intergenic
953777099 3:45829210-45829232 TCCTGGATCTTGTTTTTGACTGG + Intronic
954101531 3:48376747-48376769 TCTAGGCTCTTGATTCTGTCTGG - Intronic
960023811 3:112986676-112986698 TCCCTGCTCTTGCTTCTGTCAGG + Intergenic
963409954 3:144914513-144914535 TTCATGATCTTGCTTTTAACTGG + Intergenic
965014554 3:163140253-163140275 TCCAGGCCTTTGCTTCTGAATGG - Intergenic
966133757 3:176674698-176674720 TCCATGATCTTTCATCTGTCTGG + Intergenic
966457178 3:180130551-180130573 TACAAGATATTGCTTCTGAGAGG + Intergenic
969014876 4:4097364-4097386 TTCTTGATCTTGCTTCTGAGAGG - Intergenic
970399232 4:15701925-15701947 TCCAGGATTTTGCATCTATCAGG + Intronic
972131620 4:35842861-35842883 TCCAAGATCAAGCTGCTGACAGG + Intergenic
972627748 4:40817737-40817759 CCCAGGGTCTTGCTTTTTACAGG - Intronic
974295448 4:59993468-59993490 TTCAAGATCTTGTTGCTGACTGG + Intergenic
975059336 4:69978312-69978334 TCCAGGCTCATCATTCTGACTGG - Intergenic
979101868 4:116627289-116627311 TGCATGATCTTGCTTATAACTGG - Intergenic
979494589 4:121369637-121369659 TCCAGAATCATACTTCTGAAGGG + Intronic
980136554 4:128863611-128863633 TCCAGGATCCTGCCTCTTCCAGG - Intronic
983009717 4:162532307-162532329 TCCAGGAAGTTGCTTCTCCCTGG - Intergenic
986650507 5:9959024-9959046 TCCAGGAAGTTGCTTCTCCCTGG + Intergenic
996028102 5:118673802-118673824 TACAGGGTCTTTCTTCTGATTGG - Intergenic
996213471 5:120839900-120839922 TCCAGGAAGTTGCTTCTCCCAGG - Intergenic
996755205 5:126927750-126927772 TTCAGGACCTTCCTTCTGAGTGG - Intronic
997308982 5:132864150-132864172 TCCAGGAGCCTGCTTGTGCCGGG + Exonic
997399178 5:133589311-133589333 CCCAGAACCTTGCTTCTGAAAGG + Intronic
998358720 5:141565498-141565520 TCCAGGAACTGGCTTTAGACAGG + Intronic
999283980 5:150383080-150383102 GCCAGGGTCTTGCTTCTGGCAGG - Intronic
1001055573 5:168446991-168447013 TCTGGGATCCTGTTTCTGACCGG + Intronic
1001255004 5:170176828-170176850 TCCAGGAGCTTGCTGCTCTCTGG + Intergenic
1004458692 6:15815963-15815985 ACCAGTTTCTTGCATCTGACTGG + Intergenic
1006147949 6:31970464-31970486 TTCAGGAGCTTGTGTCTGACAGG + Exonic
1007130847 6:39472070-39472092 TCCAGGAGTTTGCTTGTGAAGGG - Intronic
1008074079 6:47127615-47127637 TCCATGATCTTACTTATGAAAGG - Intergenic
1009214648 6:60906636-60906658 TCCATGTTCTTGCCTATGACAGG + Intergenic
1010940407 6:81910663-81910685 TCCACGATTTTGCCTCTCACTGG - Intergenic
1011294266 6:85809596-85809618 CCCAGGAACTTGCTTCTCCCTGG - Intergenic
1013212308 6:107998099-107998121 TCCAGGATCAAGCTGCTGGCAGG + Intergenic
1014823492 6:126020420-126020442 TTCAGAATCTGGCATCTGACAGG - Intronic
1017223780 6:151996394-151996416 TCCATGATCCTTCTTCTGCCTGG + Intronic
1017253702 6:152309720-152309742 TCCAGGGTGTTGAATCTGACAGG - Intronic
1020747407 7:12094652-12094674 TGCTGGATCTTCATTCTGACTGG - Intergenic
1023230603 7:38023836-38023858 TCCAGGGTCTGGGTTCTGAGAGG - Intronic
1024811099 7:53213280-53213302 CCCAGATTCTTGTTTCTGACTGG + Intergenic
1025082491 7:55995733-55995755 TCCAGGATCCTGCATCTGGGAGG - Intronic
1026630108 7:72030644-72030666 TCCTGGACCTTGCTTCAGCCTGG - Intronic
1027486228 7:78765155-78765177 CCCAGGATCTCCCTTCTGTCAGG - Intronic
1028096121 7:86763301-86763323 TCCTGGAGCATTCTTCTGACAGG - Intronic
1029180525 7:98698153-98698175 TCCAAGATCCTGCTGCTAACTGG - Intergenic
1035072706 7:156156942-156156964 TCAGGGATCTTGCCTCTGCCAGG + Intergenic
1035079272 7:156202749-156202771 CCCAGGATCTGGCTTTTGATGGG + Intergenic
1037808659 8:22072889-22072911 CCCAGGATTTTGCTTTTGAAGGG + Intronic
1038912291 8:31979240-31979262 CCCAGGTTCTTGCTTGTGAATGG + Intronic
1040317120 8:46269751-46269773 TCCAAAATCTTGTTTCTAACTGG + Intergenic
1040875046 8:52142099-52142121 TCCAGGACCAAGTTTCTGACAGG + Intronic
1041232510 8:55768021-55768043 TCCAGGATACTGCTTCTGCAAGG - Intronic
1045033317 8:98157903-98157925 TTCAGGATCTTGCTCCTGAATGG - Exonic
1048128367 8:131663121-131663143 TCCAGGAAGTTGCTTCTTCCTGG - Intergenic
1057979330 9:99643350-99643372 TCCATGATGTTGCTTATGGCAGG - Intergenic
1062396087 9:136353451-136353473 CCCAGGGTCCTGCTTCTGAGGGG + Intronic
1186479180 X:9883154-9883176 TCCAGGAGCTTGCAGCTGAGTGG + Intronic
1187547959 X:20270484-20270506 TCCAATATTTTGGTTCTGACTGG - Intergenic
1188878097 X:35457260-35457282 TCCAGGATAATTCATCTGACAGG - Intergenic
1189033286 X:37471117-37471139 TTCAAGAGTTTGCTTCTGACAGG + Intronic
1189867430 X:45345822-45345844 TCCAGGATCTTGCTGCCTTCTGG + Intergenic
1190381836 X:49846820-49846842 TCAAGGATCTTGCTTTTGCTGGG - Intergenic
1192434531 X:71134903-71134925 CTCAGGAACTTGCTTCTGGCTGG + Intronic
1193202898 X:78713326-78713348 TCCATGATCTTGTGTCTCACTGG - Intergenic
1195245155 X:102988650-102988672 CCCATGCTCTTGCTTCTGATGGG + Intergenic
1197564075 X:128059774-128059796 TCCATGCTCTTGCTTCTGTGGGG - Intergenic
1201994399 Y:20068622-20068644 TAGAGTTTCTTGCTTCTGACAGG - Intergenic
1201994648 Y:20071869-20071891 TCCAGTTTCTTCCTTCTGGCAGG - Intergenic
1201997367 Y:20108093-20108115 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1201998004 Y:20116379-20116401 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202000431 Y:20148965-20148987 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202000620 Y:20151463-20151485 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202003366 Y:20188248-20188270 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202005799 Y:20270072-20270094 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202006256 Y:20276173-20276195 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202007916 Y:20298272-20298294 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202007934 Y:20298520-20298542 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202008179 Y:20301882-20301904 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202008414 Y:20304997-20305019 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202008584 Y:20307113-20307135 TCCAGTTTCTTTCTTCTGGCAGG + Intergenic
1202008670 Y:20308236-20308258 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1202008959 Y:20311850-20311872 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic
1203337261 Y_KI270740v1_random:17364-17386 TCCAGTTTCTTCCTTCTGGCAGG + Intergenic